Incidental Mutation 'R5077:Pi4k2a'
ID401963
Institutional Source Beutler Lab
Gene Symbol Pi4k2a
Ensembl Gene ENSMUSG00000025178
Gene Namephosphatidylinositol 4-kinase type 2 alpha
Synonyms
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42090435-42122218 bp(+) (GRCm38)
Type of Mutationunclassified (4943 bp from exon)
DNA Base Change (assembly) T to C at 42119836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018965] [ENSMUST00000066778] [ENSMUST00000161873]
Predicted Effect probably null
Transcript: ENSMUST00000018965
SMART Domains Protein: ENSMUSP00000018965
Gene: ENSMUSG00000018821

DomainStartEndE-ValueType
Pfam:TC1 1 76 2.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066778
AA Change: L441P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: L441P

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
Pfam:PI3_PI4_kinase 133 431 1.7e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161873
SMART Domains Protein: ENSMUSP00000124617
Gene: ENSMUSG00000018821

DomainStartEndE-ValueType
Pfam:TC1 1 76 6.6e-34 PFAM
Meta Mutation Damage Score 0.7486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Pi4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Pi4k2a APN 19 42104979 missense probably damaging 1.00
IGL02959:Pi4k2a APN 19 42113071 missense probably benign 0.42
R1570:Pi4k2a UTSW 19 42100644 missense probably benign 0.33
R1992:Pi4k2a UTSW 19 42115938 missense probably damaging 1.00
R2113:Pi4k2a UTSW 19 42115071 missense possibly damaging 0.78
R2358:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R2410:Pi4k2a UTSW 19 42104877 missense possibly damaging 0.55
R3547:Pi4k2a UTSW 19 42090548 missense probably benign 0.10
R3708:Pi4k2a UTSW 19 42090931 nonsense probably null
R3712:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R3954:Pi4k2a UTSW 19 42115899 missense probably damaging 0.98
R4654:Pi4k2a UTSW 19 42113105 critical splice donor site probably null
R5386:Pi4k2a UTSW 19 42090515 missense probably damaging 0.99
R5846:Pi4k2a UTSW 19 42115038 missense probably benign 0.01
R5867:Pi4k2a UTSW 19 42105485 critical splice donor site probably null
R5878:Pi4k2a UTSW 19 42100641 missense probably benign 0.02
R6502:Pi4k2a UTSW 19 42090932 missense probably benign 0.04
R7042:Pi4k2a UTSW 19 42104898 missense probably benign 0.18
R7269:Pi4k2a UTSW 19 42090686 missense probably damaging 1.00
R7819:Pi4k2a UTSW 19 42090574 missense probably benign
Z1177:Pi4k2a UTSW 19 42104925 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCCTACTGTTGGAACTAGC -3'
(R):5'- TCTGAAAGGCTCTGCTGTGC -3'

Sequencing Primer
(F):5'- TGGAACTAGCCTGCTTCCATGG -3'
(R):5'- TTCTGCGAACCTGGGACTC -3'
Posted On2016-07-22