Incidental Mutation 'R0415:Pth2r'
ID40197
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0415 (G1)
Quality Score177
Status Validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65388439 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 424 (M424V)
Ref Sequence ENSEMBL: ENSMUSP00000027083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083]
Predicted Effect probably benign
Transcript: ENSMUST00000027083
AA Change: M424V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: M424V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Fryl T C 5: 73,098,414 Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rad51c A G 11: 87,397,655 L234P probably damaging Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Sfswap A T 5: 129,504,126 D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Trove2 G T 1: 143,760,075 N444K probably benign Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R7919:Pth2r UTSW 1 65351563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTTGAGGTGTATGGAACACACAG -3'
(R):5'- CCTGGAAGACTCCATCACTGGACTATC -3'

Sequencing Primer
(F):5'- AGATCTGAAGAGTCCCTGGC -3'
(R):5'- TTGGCAGTCCTGCTCAGAAC -3'
Posted On2013-05-23