Incidental Mutation 'R5105:Dclk1'
ID 401972
Institutional Source Beutler Lab
Gene Symbol Dclk1
Ensembl Gene ENSMUSG00000027797
Gene Name doublecortin-like kinase 1
Synonyms CPG16, Click-I, Dcamkl1, Dcl, 1700113D08Rik, 2810480F11Rik, DCLK
MMRRC Submission 042693-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.693) question?
Stock # R5105 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 55149785-55446489 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 55163360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 151 (S151A)
Ref Sequence ENSEMBL: ENSMUSP00000050034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054237] [ENSMUST00000167204] [ENSMUST00000196745]
AlphaFold Q9JLM8
Predicted Effect probably benign
Transcript: ENSMUST00000054237
AA Change: S151A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050034
Gene: ENSMUSG00000027797
AA Change: S151A

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
S_TKc 406 663 1.71e-104 SMART
low complexity region 736 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167204
AA Change: S151A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129334
Gene: ENSMUSG00000027797
AA Change: S151A

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196745
AA Change: S151A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143659
Gene: ENSMUSG00000027797
AA Change: S151A

DomainStartEndE-ValueType
DCX 52 143 7.3e-46 SMART
DCX 181 269 1.2e-37 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
S_TKc 390 646 8.3e-107 SMART
low complexity region 719 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198154
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a null allele lack the corpus callosum and hippocampal commissure and show aberrant interhemispheric axonal projections. Mice homozygous for a different null allele have normal gross brain architecture but show axonal and dendritic defects following knockdown of Dcx expression. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btbd8 T G 5: 107,658,337 (GRCm39) S1124A possibly damaging Het
Camsap1 A G 2: 25,830,941 (GRCm39) S445P probably damaging Het
Ccdc92 G A 5: 124,912,858 (GRCm39) P224S probably damaging Het
Cep135 T C 5: 76,741,939 (GRCm39) V125A probably benign Het
Cep192 T A 18: 67,999,612 (GRCm39) C2159S probably benign Het
Col1a1 G T 11: 94,833,211 (GRCm39) R404L unknown Het
Col6a3 A T 1: 90,725,862 (GRCm39) M1382K possibly damaging Het
Cyp4a12b T C 4: 115,290,958 (GRCm39) S329P probably damaging Het
Ddhd1 A T 14: 45,894,864 (GRCm39) V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 (GRCm39) probably null Het
Dnah10 A G 5: 124,888,546 (GRCm39) E3050G probably benign Het
Dync1h1 T A 12: 110,584,366 (GRCm39) F590I probably damaging Het
Eif4b T C 15: 101,992,631 (GRCm39) Y63H probably benign Het
Fscb T C 12: 64,520,110 (GRCm39) E452G possibly damaging Het
Gpx3 A T 11: 54,797,980 (GRCm39) T39S possibly damaging Het
Grin2b T A 6: 135,709,439 (GRCm39) Y1369F probably benign Het
Kank4 A T 4: 98,667,396 (GRCm39) N350K probably benign Het
Kdm5d A G Y: 941,752 (GRCm39) K1318E probably benign Het
Large1 A T 8: 73,578,872 (GRCm39) Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,091,435 (GRCm39) probably null Het
Lrrc47 A G 4: 154,096,673 (GRCm39) Q156R probably damaging Het
Lrriq4 T C 3: 30,704,632 (GRCm39) L220P probably damaging Het
Matn2 A G 15: 34,355,814 (GRCm39) D273G possibly damaging Het
Myo18b T A 5: 112,988,644 (GRCm39) I981F probably damaging Het
Or1q1 G A 2: 36,887,469 (GRCm39) probably null Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Or5aq1 A G 2: 86,966,554 (GRCm39) I37T probably benign Het
Or6b13 A G 7: 139,782,462 (GRCm39) Y74H probably damaging Het
Or8d6 T C 9: 39,853,694 (GRCm39) V46A probably benign Het
Pkdrej T C 15: 85,700,585 (GRCm39) T1784A probably damaging Het
Ppp3cb A G 14: 20,559,490 (GRCm39) V422A possibly damaging Het
Rlf G A 4: 121,007,564 (GRCm39) T472I probably damaging Het
Scaf11 T C 15: 96,318,313 (GRCm39) E417G probably damaging Het
Shisa2 A T 14: 59,867,263 (GRCm39) T172S possibly damaging Het
Siglec1 T A 2: 130,922,320 (GRCm39) Q585L possibly damaging Het
Sorcs1 A T 19: 50,213,579 (GRCm39) M716K possibly damaging Het
Sparcl1 C T 5: 104,233,629 (GRCm39) M573I probably damaging Het
Stxbp5l C A 16: 36,962,734 (GRCm39) V774F probably benign Het
Tcaf3 A G 6: 42,568,259 (GRCm39) F699S probably damaging Het
Tmem87b T C 2: 128,673,509 (GRCm39) V251A probably damaging Het
Trpc6 T A 9: 8,649,471 (GRCm39) N560K probably benign Het
Trpv4 T A 5: 114,764,981 (GRCm39) I678F probably damaging Het
Ttc3 A T 16: 94,267,793 (GRCm39) H1935L possibly damaging Het
Vmn2r59 T A 7: 41,696,529 (GRCm39) Y71F probably benign Het
Wdfy3 A G 5: 102,003,415 (GRCm39) I2900T probably damaging Het
Zfp184 A G 13: 22,143,799 (GRCm39) T502A possibly damaging Het
Zmym6 A G 4: 127,017,551 (GRCm39) I1019V probably benign Het
Other mutations in Dclk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dclk1 APN 3 55,154,707 (GRCm39) missense probably damaging 1.00
IGL02148:Dclk1 APN 3 55,407,520 (GRCm39) missense probably damaging 1.00
IGL02901:Dclk1 APN 3 55,395,208 (GRCm39) splice site probably benign
IGL03086:Dclk1 APN 3 55,154,788 (GRCm39) missense probably damaging 0.96
IGL03213:Dclk1 APN 3 55,387,805 (GRCm39) nonsense probably null
R0037:Dclk1 UTSW 3 55,163,480 (GRCm39) missense probably benign 0.02
R0316:Dclk1 UTSW 3 55,410,313 (GRCm39) missense probably damaging 1.00
R0885:Dclk1 UTSW 3 55,394,728 (GRCm39) missense probably damaging 1.00
R1211:Dclk1 UTSW 3 55,288,244 (GRCm39) missense probably benign 0.05
R1234:Dclk1 UTSW 3 55,397,298 (GRCm39) missense probably damaging 1.00
R1540:Dclk1 UTSW 3 55,385,244 (GRCm39) missense probably damaging 1.00
R1928:Dclk1 UTSW 3 55,154,942 (GRCm39) missense possibly damaging 0.48
R2081:Dclk1 UTSW 3 55,429,346 (GRCm39) critical splice donor site probably null
R2152:Dclk1 UTSW 3 55,154,633 (GRCm39) missense probably damaging 0.97
R2153:Dclk1 UTSW 3 55,154,633 (GRCm39) missense probably damaging 0.97
R2213:Dclk1 UTSW 3 55,387,854 (GRCm39) missense probably damaging 1.00
R3745:Dclk1 UTSW 3 55,154,863 (GRCm39) missense possibly damaging 0.87
R3899:Dclk1 UTSW 3 55,154,750 (GRCm39) missense probably damaging 0.99
R4569:Dclk1 UTSW 3 55,154,831 (GRCm39) missense probably damaging 1.00
R4851:Dclk1 UTSW 3 55,387,811 (GRCm39) missense probably damaging 1.00
R4890:Dclk1 UTSW 3 55,429,353 (GRCm39) missense probably benign
R5175:Dclk1 UTSW 3 55,154,648 (GRCm39) missense possibly damaging 0.80
R5364:Dclk1 UTSW 3 55,163,366 (GRCm39) missense possibly damaging 0.95
R5613:Dclk1 UTSW 3 55,424,360 (GRCm39) missense probably benign 0.15
R5819:Dclk1 UTSW 3 55,397,285 (GRCm39) missense probably damaging 0.98
R6113:Dclk1 UTSW 3 55,397,240 (GRCm39) missense probably benign 0.00
R6162:Dclk1 UTSW 3 55,163,575 (GRCm39) missense probably benign 0.02
R6190:Dclk1 UTSW 3 55,395,232 (GRCm39) missense probably damaging 1.00
R6193:Dclk1 UTSW 3 55,424,292 (GRCm39) critical splice acceptor site probably null
R6380:Dclk1 UTSW 3 55,154,615 (GRCm39) missense probably damaging 1.00
R6406:Dclk1 UTSW 3 55,387,827 (GRCm39) missense probably damaging 1.00
R6543:Dclk1 UTSW 3 55,407,552 (GRCm39) missense probably damaging 1.00
R6745:Dclk1 UTSW 3 55,385,229 (GRCm39) missense probably damaging 1.00
R6970:Dclk1 UTSW 3 55,374,022 (GRCm39) intron probably benign
R7037:Dclk1 UTSW 3 55,370,469 (GRCm39) missense probably damaging 1.00
R7086:Dclk1 UTSW 3 55,395,333 (GRCm39) critical splice donor site probably null
R7163:Dclk1 UTSW 3 55,163,549 (GRCm39) nonsense probably null
R7198:Dclk1 UTSW 3 55,385,296 (GRCm39) missense possibly damaging 0.70
R7843:Dclk1 UTSW 3 55,163,298 (GRCm39) missense probably damaging 1.00
R8476:Dclk1 UTSW 3 55,441,100 (GRCm39) missense probably damaging 1.00
R8677:Dclk1 UTSW 3 55,409,840 (GRCm39) missense probably damaging 0.96
R9060:Dclk1 UTSW 3 55,163,575 (GRCm39) missense probably benign 0.02
R9332:Dclk1 UTSW 3 55,370,500 (GRCm39) missense probably damaging 0.98
R9377:Dclk1 UTSW 3 55,429,374 (GRCm39) missense possibly damaging 0.72
R9384:Dclk1 UTSW 3 55,154,936 (GRCm39) missense possibly damaging 0.81
R9569:Dclk1 UTSW 3 55,387,852 (GRCm39) missense probably benign 0.16
R9616:Dclk1 UTSW 3 55,387,854 (GRCm39) missense probably damaging 1.00
R9770:Dclk1 UTSW 3 55,358,492 (GRCm39) missense probably damaging 0.99
Z1088:Dclk1 UTSW 3 55,407,526 (GRCm39) missense probably damaging 1.00
Z1177:Dclk1 UTSW 3 55,163,434 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACGCCAGTCTGTATAAGAAGTG -3'
(R):5'- TTCAGCAGGATTCTGACAGC -3'

Sequencing Primer
(F):5'- CCATTGATTTGAAAAGCATAGGC -3'
(R):5'- AGGATTCTGACAGCCTTCCGTG -3'
Posted On 2016-07-22