Incidental Mutation 'R5105:Dclk1'
ID401972
Institutional Source Beutler Lab
Gene Symbol Dclk1
Ensembl Gene ENSMUSG00000027797
Gene Namedoublecortin-like kinase 1
Synonyms2810480F11Rik, Dcamkl1, CPG16, Click-I, Dcl, DCLK, 1700113D08Rik
MMRRC Submission 042693-MU
Accession Numbers

Genbank: NM_019978; MGI: 1330861

Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R5105 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location55242364-55539068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55255939 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 151 (S151A)
Ref Sequence ENSEMBL: ENSMUSP00000050034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054237] [ENSMUST00000167204] [ENSMUST00000196745]
Predicted Effect probably benign
Transcript: ENSMUST00000054237
AA Change: S151A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050034
Gene: ENSMUSG00000027797
AA Change: S151A

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
S_TKc 406 663 1.71e-104 SMART
low complexity region 736 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167204
AA Change: S151A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129334
Gene: ENSMUSG00000027797
AA Change: S151A

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196745
AA Change: S151A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143659
Gene: ENSMUSG00000027797
AA Change: S151A

DomainStartEndE-ValueType
DCX 52 143 7.3e-46 SMART
DCX 181 269 1.2e-37 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
S_TKc 390 646 8.3e-107 SMART
low complexity region 719 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198154
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a null allele lack the corpus callosum and hippocampal commissure and show aberrant interhemispheric axonal projections. Mice homozygous for a different null allele have normal gross brain architecture but show axonal and dendritic defects following knockdown of Dcx expression. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Ccdc92 G A 5: 124,835,794 P224S probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Ddhd1 A T 14: 45,657,407 V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Fscb T C 12: 64,473,336 E452G possibly damaging Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Olfr974 T C 9: 39,942,398 V46A probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Shisa2 A T 14: 59,629,814 T172S possibly damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Trpv4 T A 5: 114,626,920 I678F probably damaging Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Dclk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dclk1 APN 3 55247286 missense probably damaging 1.00
IGL02148:Dclk1 APN 3 55500099 missense probably damaging 1.00
IGL02901:Dclk1 APN 3 55487787 splice site probably benign
IGL03086:Dclk1 APN 3 55247367 missense probably damaging 0.96
IGL03213:Dclk1 APN 3 55480384 nonsense probably null
R0037:Dclk1 UTSW 3 55256059 missense probably benign 0.02
R0316:Dclk1 UTSW 3 55502892 missense probably damaging 1.00
R0885:Dclk1 UTSW 3 55487307 missense probably damaging 1.00
R1211:Dclk1 UTSW 3 55380823 missense probably benign 0.05
R1234:Dclk1 UTSW 3 55489877 missense probably damaging 1.00
R1540:Dclk1 UTSW 3 55477823 missense probably damaging 1.00
R1928:Dclk1 UTSW 3 55247521 missense possibly damaging 0.48
R2081:Dclk1 UTSW 3 55521925 critical splice donor site probably null
R2152:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2153:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2213:Dclk1 UTSW 3 55480433 missense probably damaging 1.00
R3745:Dclk1 UTSW 3 55247442 missense possibly damaging 0.87
R3899:Dclk1 UTSW 3 55247329 missense probably damaging 0.99
R4569:Dclk1 UTSW 3 55247410 missense probably damaging 1.00
R4851:Dclk1 UTSW 3 55480390 missense probably damaging 1.00
R4890:Dclk1 UTSW 3 55521932 missense probably benign
R5175:Dclk1 UTSW 3 55247227 missense possibly damaging 0.80
R5364:Dclk1 UTSW 3 55255945 missense possibly damaging 0.95
R5613:Dclk1 UTSW 3 55516939 missense probably benign 0.15
R5819:Dclk1 UTSW 3 55489864 missense probably damaging 0.98
R6113:Dclk1 UTSW 3 55489819 missense probably benign 0.00
R6162:Dclk1 UTSW 3 55256154 missense probably benign 0.02
R6190:Dclk1 UTSW 3 55487811 missense probably damaging 1.00
R6193:Dclk1 UTSW 3 55516871 critical splice acceptor site probably null
R6380:Dclk1 UTSW 3 55247194 missense probably damaging 1.00
R6406:Dclk1 UTSW 3 55480406 missense probably damaging 1.00
R6543:Dclk1 UTSW 3 55500131 missense probably damaging 1.00
R6745:Dclk1 UTSW 3 55477808 missense probably damaging 1.00
R6970:Dclk1 UTSW 3 55466601 intron probably benign
R7037:Dclk1 UTSW 3 55463048 missense probably damaging 1.00
R7086:Dclk1 UTSW 3 55487912 critical splice donor site probably null
R7163:Dclk1 UTSW 3 55256128 nonsense probably null
R7198:Dclk1 UTSW 3 55477875 missense possibly damaging 0.70
R7843:Dclk1 UTSW 3 55255877 missense probably damaging 1.00
R7926:Dclk1 UTSW 3 55255877 missense probably damaging 1.00
Z1088:Dclk1 UTSW 3 55500105 missense probably damaging 1.00
Z1177:Dclk1 UTSW 3 55256013 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACGCCAGTCTGTATAAGAAGTG -3'
(R):5'- TTCAGCAGGATTCTGACAGC -3'

Sequencing Primer
(F):5'- CCATTGATTTGAAAAGCATAGGC -3'
(R):5'- AGGATTCTGACAGCCTTCCGTG -3'
Posted On2016-07-22