Incidental Mutation 'R5105:Trpv4'
ID401982
Institutional Source Beutler Lab
Gene Symbol Trpv4
Ensembl Gene ENSMUSG00000014158
Gene Nametransient receptor potential cation channel, subfamily V, member 4
SynonymsVROAC, 0610033B08Rik, Trp12, VR-OAC, VRL-2, OTRPC4
MMRRC Submission 042693-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R5105 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114622152-114658421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114626920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 678 (I678F)
Ref Sequence ENSEMBL: ENSMUSP00000107844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071968] [ENSMUST00000112217] [ENSMUST00000112219] [ENSMUST00000112222] [ENSMUST00000112225]
Predicted Effect probably damaging
Transcript: ENSMUST00000071968
AA Change: I678F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071859
Gene: ENSMUSG00000014158
AA Change: I678F

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 468 730 9.9e-13 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112217
AA Change: I618F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107836
Gene: ENSMUSG00000014158
AA Change: I618F

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 1e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 2e-12 BLAST
ANK 369 397 1.02e3 SMART
transmembrane domain 409 431 N/A INTRINSIC
Pfam:Ion_trans 455 658 3.3e-8 PFAM
Blast:PHB 693 744 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112219
AA Change: I571F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107838
Gene: ENSMUSG00000014158
AA Change: I571F

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 350 1.02e3 SMART
transmembrane domain 362 384 N/A INTRINSIC
Pfam:Ion_trans 408 611 3e-8 PFAM
Blast:PHB 646 697 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112222
AA Change: I631F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107840
Gene: ENSMUSG00000014158
AA Change: I631F

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 351 3.49e0 SMART
low complexity region 368 378 N/A INTRINSIC
Blast:ANK 395 420 1e-6 BLAST
Pfam:Ion_trans 468 671 3.4e-8 PFAM
Blast:PHB 706 757 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112225
AA Change: I678F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107844
Gene: ENSMUSG00000014158
AA Change: I678F

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 515 718 3.4e-8 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141828
Meta Mutation Damage Score 0.8259 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a null allele show abnormal touch/ nociception and late-onset hearing loss. Homozygotes for a different null allele show impaired bladder voiding, abnormalities in touch/ nociception, osmotic regulation and vasodilation, ocular hypertension but no hearing or vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Ccdc92 G A 5: 124,835,794 P224S probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Dclk1 T G 3: 55,255,939 S151A probably benign Het
Ddhd1 A T 14: 45,657,407 V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Fscb T C 12: 64,473,336 E452G possibly damaging Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Olfr974 T C 9: 39,942,398 V46A probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Shisa2 A T 14: 59,629,814 T172S possibly damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Trpv4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trpv4 APN 5 114628625 missense probably damaging 1.00
IGL01804:Trpv4 APN 5 114644786 missense possibly damaging 0.77
IGL01955:Trpv4 APN 5 114622682 nonsense probably null
IGL02115:Trpv4 APN 5 114625029 missense probably damaging 1.00
IGL02375:Trpv4 APN 5 114636357 missense probably benign 0.10
IGL02870:Trpv4 APN 5 114625056 missense probably damaging 1.00
PIT4472001:Trpv4 UTSW 5 114626923 missense probably damaging 0.99
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0217:Trpv4 UTSW 5 114634661 missense possibly damaging 0.68
R0346:Trpv4 UTSW 5 114630529 splice site probably benign
R0358:Trpv4 UTSW 5 114630432 missense probably damaging 1.00
R1745:Trpv4 UTSW 5 114633154 missense probably damaging 1.00
R1880:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R1881:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R2018:Trpv4 UTSW 5 114634605 missense probably damaging 1.00
R2093:Trpv4 UTSW 5 114635504 missense probably damaging 1.00
R2172:Trpv4 UTSW 5 114644710 missense probably damaging 1.00
R2679:Trpv4 UTSW 5 114635552 missense probably damaging 1.00
R3699:Trpv4 UTSW 5 114634800 missense probably damaging 1.00
R4731:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4732:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4733:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4822:Trpv4 UTSW 5 114630022 missense possibly damaging 0.66
R4985:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R4987:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R5026:Trpv4 UTSW 5 114622654 makesense probably null
R5236:Trpv4 UTSW 5 114622795 missense possibly damaging 0.81
R5330:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5331:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5396:Trpv4 UTSW 5 114623614 missense possibly damaging 0.77
R5423:Trpv4 UTSW 5 114636445 missense probably benign 0.25
R5667:Trpv4 UTSW 5 114634556 missense probably damaging 1.00
R5896:Trpv4 UTSW 5 114622647 utr 3 prime probably benign
R6239:Trpv4 UTSW 5 114644826 missense probably benign
R6762:Trpv4 UTSW 5 114625110 missense probably benign 0.07
R6952:Trpv4 UTSW 5 114633202 missense probably damaging 1.00
R7191:Trpv4 UTSW 5 114633140 missense probably benign
R7343:Trpv4 UTSW 5 114636459 missense probably benign 0.42
Z1177:Trpv4 UTSW 5 114634612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTCCAGATGTGCTTGC -3'
(R):5'- TCCTCAGAGAGTTTGGGGAG -3'

Sequencing Primer
(F):5'- AGATGTGCTTGCTCTCCTTGGAC -3'
(R):5'- CCATCTAGTGGGGTAGCACCTC -3'
Posted On2016-07-22