Incidental Mutation 'R5105:Olfr974'
ID401993
Institutional Source Beutler Lab
Gene Symbol Olfr974
Ensembl Gene ENSMUSG00000051493
Gene Nameolfactory receptor 974
SynonymsGA_x6K02T2PVTD-33640290-33641222, MOR171-1
MMRRC Submission 042693-MU
Accession Numbers

Genbank: NM_147107

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5105 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39937501-39945170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39942398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 46 (V46A)
Ref Sequence ENSEMBL: ENSMUSP00000149630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062833] [ENSMUST00000213246]
Predicted Effect probably benign
Transcript: ENSMUST00000062833
AA Change: V46A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000062985
Gene: ENSMUSG00000051493
AA Change: V46A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.6e-52 PFAM
Pfam:7tm_1 41 290 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213246
AA Change: V46A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Ccdc92 G A 5: 124,835,794 P224S probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Dclk1 T G 3: 55,255,939 S151A probably benign Het
Ddhd1 A T 14: 45,657,407 V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Fscb T C 12: 64,473,336 E452G possibly damaging Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Shisa2 A T 14: 59,629,814 T172S possibly damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Trpv4 T A 5: 114,626,920 I678F probably damaging Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Olfr974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr974 APN 9 39942680 missense probably benign 0.08
IGL01638:Olfr974 APN 9 39942520 missense probably benign 0.03
IGL02826:Olfr974 APN 9 39942958 missense probably damaging 1.00
IGL03136:Olfr974 APN 9 39943036 missense probably damaging 1.00
H2330:Olfr974 UTSW 9 39942920 missense probably damaging 1.00
R0005:Olfr974 UTSW 9 39942956 missense probably benign
R0106:Olfr974 UTSW 9 39942823 frame shift probably null
R1769:Olfr974 UTSW 9 39942955 missense probably benign 0.43
R1870:Olfr974 UTSW 9 39942821 missense probably damaging 0.99
R4416:Olfr974 UTSW 9 39942428 missense probably damaging 1.00
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R5273:Olfr974 UTSW 9 39942557 missense probably benign
R6520:Olfr974 UTSW 9 39942362 missense possibly damaging 0.90
R7203:Olfr974 UTSW 9 39942509 missense probably benign 0.01
R8037:Olfr974 UTSW 9 39942881 missense probably damaging 0.98
R8038:Olfr974 UTSW 9 39942881 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATGATAGCTGGTGTTCAAGC -3'
(R):5'- AGAGCTGGACCATGCATTCAG -3'

Sequencing Primer
(F):5'- GCTCTATTGAAACCTAAGTCATTTGC -3'
(R):5'- CCATGCATTCAGGAAAGGCTG -3'
Posted On2016-07-22