Incidental Mutation 'R5105:Fscb'
ID401996
Institutional Source Beutler Lab
Gene Symbol Fscb
Ensembl Gene ENSMUSG00000043060
Gene Namefibrous sheath CABYR binding protein
SynonymsEG623046
MMRRC Submission 042693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5105 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64471330-64474690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64473336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 452 (E452G)
Ref Sequence ENSEMBL: ENSMUSP00000051554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059833
AA Change: E452G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051554
Gene: ENSMUSG00000043060
AA Change: E452G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
internal_repeat_1 295 465 2.4e-7 PROSPERO
low complexity region 483 501 N/A INTRINSIC
low complexity region 510 547 N/A INTRINSIC
low complexity region 558 595 N/A INTRINSIC
low complexity region 599 622 N/A INTRINSIC
low complexity region 641 661 N/A INTRINSIC
low complexity region 673 708 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
internal_repeat_1 736 895 2.4e-7 PROSPERO
internal_repeat_2 751 871 6.17e-6 PROSPERO
low complexity region 899 916 N/A INTRINSIC
internal_repeat_2 919 1046 6.17e-6 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Ccdc92 G A 5: 124,835,794 P224S probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Dclk1 T G 3: 55,255,939 S151A probably benign Het
Ddhd1 A T 14: 45,657,407 V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Olfr974 T C 9: 39,942,398 V46A probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Shisa2 A T 14: 59,629,814 T172S possibly damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Trpv4 T A 5: 114,626,920 I678F probably damaging Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Fscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fscb APN 12 64473381 missense possibly damaging 0.46
IGL01099:Fscb APN 12 64472101 missense unknown
IGL01394:Fscb APN 12 64473804 missense possibly damaging 0.83
IGL02570:Fscb APN 12 64472178 missense unknown
IGL02974:Fscb APN 12 64471525 missense unknown
IGL03150:Fscb APN 12 64472430 missense unknown
IGL03407:Fscb APN 12 64473495 missense probably damaging 0.96
FR4548:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472565 missense unknown
R0056:Fscb UTSW 12 64474247 missense possibly damaging 0.66
R0490:Fscb UTSW 12 64472887 missense unknown
R0492:Fscb UTSW 12 64473518 missense possibly damaging 0.46
R0702:Fscb UTSW 12 64472001 missense unknown
R1017:Fscb UTSW 12 64473468 missense probably benign 0.07
R1672:Fscb UTSW 12 64471518 missense unknown
R1737:Fscb UTSW 12 64474581 missense possibly damaging 0.83
R1795:Fscb UTSW 12 64474401 missense probably damaging 0.99
R1969:Fscb UTSW 12 64473234 missense unknown
R1984:Fscb UTSW 12 64474683 missense unknown
R2164:Fscb UTSW 12 64473793 missense probably damaging 0.96
R2213:Fscb UTSW 12 64474116 missense possibly damaging 0.84
R2874:Fscb UTSW 12 64473436 missense probably benign 0.00
R2878:Fscb UTSW 12 64472574 missense unknown
R3873:Fscb UTSW 12 64473132 missense unknown
R4734:Fscb UTSW 12 64474470 missense possibly damaging 0.82
R4773:Fscb UTSW 12 64473690 missense probably damaging 1.00
R4940:Fscb UTSW 12 64473814 missense probably benign 0.03
R4981:Fscb UTSW 12 64473619 missense possibly damaging 0.46
R5845:Fscb UTSW 12 64472784 missense unknown
R6049:Fscb UTSW 12 64474320 missense possibly damaging 0.66
R6743:Fscb UTSW 12 64471573 missense unknown
R7026:Fscb UTSW 12 64471617 missense unknown
R7285:Fscb UTSW 12 64471549 missense unknown
R7372:Fscb UTSW 12 64471824 missense unknown
R7400:Fscb UTSW 12 64471617 missense unknown
R7563:Fscb UTSW 12 64473285 missense possibly damaging 0.82
R7748:Fscb UTSW 12 64474407 missense probably benign 0.04
R7759:Fscb UTSW 12 64474092 missense probably benign 0.03
R8026:Fscb UTSW 12 64474275 missense probably benign 0.12
R8070:Fscb UTSW 12 64474608 missense probably benign 0.04
RF011:Fscb UTSW 12 64472994 small deletion probably benign
RF019:Fscb UTSW 12 64472596 small insertion probably benign
RF038:Fscb UTSW 12 64472569 small insertion probably benign
Z1176:Fscb UTSW 12 64472930 missense unknown
Z1177:Fscb UTSW 12 64472628 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGATAGTGGAGGTGGAACTTC -3'
(R):5'- TTGCTGAAGAGACATCTGGTAAAG -3'

Sequencing Primer
(F):5'- AGGTGGAACTTCTGCAGGC -3'
(R):5'- GTTCAACATCCTCTGTCTGAAGAGAC -3'
Posted On2016-07-22