Incidental Mutation 'R5105:Ddhd1'
ID402000
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene NameDDHD domain containing 1
Synonyms9630061G18Rik, 4921528E07Rik
MMRRC Submission 042693-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5105 (G1)
Quality Score213
Status Validated
Chromosome14
Chromosomal Location45588467-45658143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45657407 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 202 (V202E)
Ref Sequence ENSEMBL: ENSMUSP00000118848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286] [ENSMUST00000226301]
Predicted Effect probably benign
Transcript: ENSMUST00000051310
AA Change: V202E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: V202E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087320
AA Change: V202E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: V202E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111828
AA Change: V202E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: V202E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147551
Predicted Effect probably benign
Transcript: ENSMUST00000149286
AA Change: V202E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697
AA Change: V202E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175426
Predicted Effect probably benign
Transcript: ENSMUST00000226301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228352
Meta Mutation Damage Score 0.1023 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Ccdc92 G A 5: 124,835,794 P224S probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Dclk1 T G 3: 55,255,939 S151A probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Fscb T C 12: 64,473,336 E452G possibly damaging Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Olfr974 T C 9: 39,942,398 V46A probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Shisa2 A T 14: 59,629,814 T172S possibly damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Trpv4 T A 5: 114,626,920 I678F probably damaging Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45616551 missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45629580 missense probably null 0.98
IGL02176:Ddhd1 APN 14 45616600 missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45605206 unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45620783 missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45610605 missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45610510 missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45610690 missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45595592 missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45601650 missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45605051 critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45605109 missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45610624 missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45608990 missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45657272 missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45610573 missense probably benign 0.00
R3756:Ddhd1 UTSW 14 45657263 missense probably damaging 1.00
R4541:Ddhd1 UTSW 14 45622856 nonsense probably null
R4737:Ddhd1 UTSW 14 45628821 intron probably benign
R5810:Ddhd1 UTSW 14 45602707 missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45602668 missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45619514 intron probably null
R6218:Ddhd1 UTSW 14 45614176 missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45657232 frame shift probably null
R6787:Ddhd1 UTSW 14 45657519 missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45602681 missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45657806 missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45657753 missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45657231 missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45657647 missense possibly damaging 0.47
Z1177:Ddhd1 UTSW 14 45657594 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTTACGGTTCCAGTACACCG -3'
(R):5'- TCGTCGTTGCGCTACTACAG -3'

Sequencing Primer
(F):5'- AGTACACCGGGTAGCACTCTC -3'
(R):5'- CTACTACAGCGAGGGCGAG -3'
Posted On2016-07-22