Incidental Mutation 'R5105:Shisa2'
ID402001
Institutional Source Beutler Lab
Gene Symbol Shisa2
Ensembl Gene ENSMUSG00000044461
Gene Nameshisa family member 2
SynonymsmShisa, Tmem46, MAd2, shisa, 9430059P22Rik
MMRRC Submission 042693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5105 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59625308-59631660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59629814 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 172 (T172S)
Ref Sequence ENSEMBL: ENSMUSP00000059391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053949
AA Change: T172S

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059391
Gene: ENSMUSG00000044461
AA Change: T172S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Shisa 35 224 6e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224155
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null alle exhibit dwarfism, delayed growth and postnatal lethality with abnormal hypothalamus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Ccdc92 G A 5: 124,835,794 P224S probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Dclk1 T G 3: 55,255,939 S151A probably benign Het
Ddhd1 A T 14: 45,657,407 V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Fscb T C 12: 64,473,336 E452G possibly damaging Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Olfr974 T C 9: 39,942,398 V46A probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Trpv4 T A 5: 114,626,920 I678F probably damaging Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Shisa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Shisa2 APN 14 59629986 missense probably damaging 1.00
IGL02320:Shisa2 APN 14 59629797 missense probably damaging 1.00
R2030:Shisa2 UTSW 14 59629685 missense probably damaging 1.00
R3686:Shisa2 UTSW 14 59629779 missense probably damaging 1.00
R4673:Shisa2 UTSW 14 59630180 missense probably damaging 1.00
R6014:Shisa2 UTSW 14 59629908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTGTGTTCTCTCTGCAG -3'
(R):5'- ACAGAGTCATGCTGTACGGC -3'

Sequencing Primer
(F):5'- GCAGTCCCCATCTACGTG -3'
(R):5'- GCATAGCCTACATATGGAGTATGC -3'
Posted On2016-07-22