Mutagenetix > Incidental Mutation

Incidental Mutation 'R5206:Ryr3'

402018

Institutional Source

Beutler Lab

Gene Symbol

Ryr3

Ensembl Gene

ENSMUSG00000057378

Gene Name

ryanodine receptor 3

Synonyms

calcium release channel isoform 3

MMRRC Submission

042781-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.321) question?

Stock #

R5206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112631355-113217096 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112844711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1352 (Y1352C)

Ref Sequence

ENSEMBL: ENSMUSP00000146449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080673
AA Change: Y1352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: Y1352C

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091818
AA Change: Y1372C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: Y1372C

Domain	Start	End	E-Value	Type
low complexity region	110	119	N/A	INTRINSIC
MIR	120	175	3.27e-4	SMART
MIR	182	227	7.52e-4	SMART
MIR	235	289	8.06e-4	SMART
MIR	295	388	8.4e-25	SMART
Pfam:RYDR_ITPR	460	655	1.2e-64	PFAM
SPRY	677	815	1.16e-24	SMART
Pfam:RyR	869	959	3.3e-38	PFAM
Pfam:RyR	983	1073	2.5e-32	PFAM
SPRY	1104	1227	7.99e-37	SMART
SPRY	1345	1485	6.25e-30	SMART
low complexity region	1777	1792	N/A	INTRINSIC
low complexity region	1793	1808	N/A	INTRINSIC
low complexity region	1952	1977	N/A	INTRINSIC
Pfam:RYDR_ITPR	2040	2248	5.8e-67	PFAM
Pfam:RyR	2616	2706	6.3e-33	PFAM
Pfam:RyR	2734	2818	6.6e-26	PFAM
low complexity region	2897	2907	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
PDB:2BCX\|B	3487	3516	1e-11	PDB
low complexity region	3557	3565	N/A	INTRINSIC
coiled coil region	3610	3639	N/A	INTRINSIC
Pfam:RIH_assoc	3744	3862	3.5e-34	PFAM
low complexity region	3880	3900	N/A	INTRINSIC
SCOP:d1sra__	3918	4014	1e-10	SMART
low complexity region	4121	4159	N/A	INTRINSIC
transmembrane domain	4203	4225	N/A	INTRINSIC
Pfam:RR_TM4-6	4252	4522	1.1e-98	PFAM
Pfam:Ion_trans	4625	4799	6.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000134358
AA Change: Y1352C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208151
AA Change: Y1352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208290
AA Change: Y1352C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,511 (GRCm38)	E487G	probably benign	Het
2610021A01Rik	A	T	7: 41,626,585 (GRCm38)	K571*	probably null	Het
A2m	T	C	6: 121,674,807 (GRCm38)	V1278A	probably damaging	Het
Abcc2	T	C	19: 43,818,150 (GRCm38)	V801A	probably damaging	Het
Acod1	T	A	14: 103,055,295 (GRCm38)	D418E	possibly damaging	Het
Bsn	G	A	9: 108,105,373 (GRCm38)	A3727V	unknown	Het
Cmah	T	G	13: 24,464,284 (GRCm38)	F501V	probably damaging	Het
Csf2rb2	T	A	15: 78,292,752 (GRCm38)	I173L	probably benign	Het
Dnah12	T	C	14: 26,769,985 (GRCm38)	W1126R	probably damaging	Het
Dock5	G	T	14: 67,763,184 (GRCm38)	A1690E	probably benign	Het
Dop1b	T	C	16: 93,801,584 (GRCm38)	L1879P	probably damaging	Het
Eif3j2	A	T	18: 43,477,582 (GRCm38)	D55E	probably benign	Het
Fam83f	G	A	15: 80,692,054 (GRCm38)	G302D	possibly damaging	Het
Fus	G	A	7: 127,969,797 (GRCm38)	G40D	unknown	Het
Glrp1	GTGCTGCTGCTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTGCTGCTGCTG	1: 88,503,275 (GRCm38)		probably benign	Het
Gxylt2	T	C	6: 100,804,615 (GRCm38)	V417A	probably damaging	Het
Hhipl1	G	A	12: 108,312,178 (GRCm38)	R255H	probably damaging	Het
Ints8	A	T	4: 11,216,477 (GRCm38)	I838N	possibly damaging	Het
Lama5	C	A	2: 180,191,304 (GRCm38)	C1579F	probably damaging	Het
Med13	C	T	11: 86,319,879 (GRCm38)	R479H	probably damaging	Het
Or51ag1	A	T	7: 103,506,102 (GRCm38)	Y281*	probably null	Het
Or5b113	G	T	19: 13,365,065 (GRCm38)	G146C	possibly damaging	Het
Or5k15	G	T	16: 58,890,018 (GRCm38)	N67K	probably damaging	Het
Or6e1	T	A	14: 54,282,698 (GRCm38)	M66L	probably benign	Het
Or9g3	T	A	2: 85,759,623 (GRCm38)	Y251F	probably benign	Het
Pak6	A	G	2: 118,693,303 (GRCm38)	E313G	probably benign	Het
Pigs	T	A	11: 78,333,723 (GRCm38)	Y145N	probably damaging	Het
Pla2g2f	T	A	4: 138,752,351 (GRCm38)	D165V	probably benign	Het
Plbd1	C	T	6: 136,641,156 (GRCm38)	V133M	probably benign	Het
Ppp1r14bl	C	T	1: 23,102,102 (GRCm38)	G44R	probably benign	Het
Scamp1	C	T	13: 94,232,107 (GRCm38)	R51H	probably damaging	Het
Skic3	G	A	13: 76,147,767 (GRCm38)	E1050K	possibly damaging	Het
Slc2a2	G	A	3: 28,708,607 (GRCm38)	V100M	probably damaging	Het
Slc38a10	C	G	11: 120,105,062 (GRCm38)	A1062P	probably damaging	Het
Snai1	T	C	2: 167,538,968 (GRCm38)	I127T	probably benign	Het
Stat4	G	A	1: 52,105,236 (GRCm38)	G692D	probably damaging	Het
Stc1	A	T	14: 69,031,599 (GRCm38)	D72V	probably damaging	Het
Tmc1	T	C	19: 20,826,660 (GRCm38)	N351S	probably damaging	Het
Trim28	A	G	7: 13,025,348 (GRCm38)	I130V	probably benign	Het
Trim39	A	G	17: 36,260,490 (GRCm38)	Y459H	probably damaging	Het
Ugt1a6b	C	A	1: 88,107,448 (GRCm38)	Y169*	probably null	Het
Vasp	T	C	7: 19,258,855 (GRCm38)		probably benign	Het
Vmn2r99	G	T	17: 19,378,606 (GRCm38)	G184V	probably benign	Het
Xrcc1	C	T	7: 24,567,563 (GRCm38)	T358I	probably damaging	Het
Zfp219	A	G	14: 52,009,565 (GRCm38)	V35A	probably benign	Het

Other mutations in Ryr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Ryr3	APN	2	112,660,149 (GRCm38)	missense	probably damaging	0.98
IGL00531:Ryr3	APN	2	112,663,012 (GRCm38)	splice site	probably benign
IGL00785:Ryr3	APN	2	112,836,103 (GRCm38)	missense	possibly damaging	0.95
IGL00901:Ryr3	APN	2	112,886,589 (GRCm38)	missense	probably damaging	1.00
IGL00910:Ryr3	APN	2	112,728,934 (GRCm38)	splice site	probably benign
IGL00970:Ryr3	APN	2	112,764,676 (GRCm38)	missense	probably damaging	1.00
IGL01083:Ryr3	APN	2	112,751,846 (GRCm38)	splice site	probably benign
IGL01105:Ryr3	APN	2	112,751,805 (GRCm38)	missense	probably damaging	1.00
IGL01287:Ryr3	APN	2	112,709,073 (GRCm38)	missense	probably damaging	1.00
IGL01343:Ryr3	APN	2	112,660,054 (GRCm38)	missense	probably damaging	1.00
IGL01472:Ryr3	APN	2	112,672,248 (GRCm38)	missense	probably benign	0.20
IGL01552:Ryr3	APN	2	112,825,883 (GRCm38)	missense	possibly damaging	0.53
IGL01594:Ryr3	APN	2	112,772,728 (GRCm38)	missense	probably damaging	1.00
IGL01723:Ryr3	APN	2	112,650,111 (GRCm38)	critical splice donor site	probably null
IGL01837:Ryr3	APN	2	112,801,320 (GRCm38)	missense	probably damaging	1.00
IGL01868:Ryr3	APN	2	112,803,158 (GRCm38)	splice site	probably benign
IGL01907:Ryr3	APN	2	112,869,001 (GRCm38)	splice site	probably benign
IGL02005:Ryr3	APN	2	112,663,263 (GRCm38)	splice site	probably benign
IGL02014:Ryr3	APN	2	112,946,915 (GRCm38)	missense	possibly damaging	0.86
IGL02109:Ryr3	APN	2	112,949,157 (GRCm38)	missense	probably benign
IGL02178:Ryr3	APN	2	112,825,799 (GRCm38)	missense	probably benign	0.17
IGL02185:Ryr3	APN	2	112,967,203 (GRCm38)	missense	probably damaging	0.99
IGL02189:Ryr3	APN	2	112,754,838 (GRCm38)	splice site	probably benign
IGL02200:Ryr3	APN	2	112,849,510 (GRCm38)	missense	probably damaging	0.98
IGL02302:Ryr3	APN	2	112,964,356 (GRCm38)	missense	probably damaging	1.00
IGL02305:Ryr3	APN	2	112,645,277 (GRCm38)	missense	probably damaging	0.96
IGL02306:Ryr3	APN	2	112,834,114 (GRCm38)	missense	probably damaging	0.98
IGL02306:Ryr3	APN	2	112,847,399 (GRCm38)	critical splice donor site	probably null
IGL02340:Ryr3	APN	2	112,947,004 (GRCm38)	splice site	probably benign
IGL02398:Ryr3	APN	2	112,847,422 (GRCm38)	missense	probably benign	0.05
IGL02407:Ryr3	APN	2	112,754,958 (GRCm38)	missense	probably damaging	1.00
IGL02426:Ryr3	APN	2	112,900,905 (GRCm38)	missense	possibly damaging	0.59
IGL02452:Ryr3	APN	2	112,833,990 (GRCm38)	missense	probably damaging	1.00
IGL02453:Ryr3	APN	2	112,681,728 (GRCm38)	splice site	probably benign
IGL02585:Ryr3	APN	2	112,712,303 (GRCm38)	missense	probably damaging	1.00
IGL02724:Ryr3	APN	2	112,902,576 (GRCm38)	critical splice donor site	probably null
IGL02817:Ryr3	APN	2	112,844,623 (GRCm38)	critical splice donor site	probably null
IGL02861:Ryr3	APN	2	112,652,841 (GRCm38)	missense	possibly damaging	0.89
IGL03038:Ryr3	APN	2	112,668,120 (GRCm38)	missense	possibly damaging	0.83
IGL03059:Ryr3	APN	2	112,800,047 (GRCm38)	missense	probably damaging	1.00
IGL03136:Ryr3	APN	2	112,675,974 (GRCm38)	splice site	probably benign
IGL03137:Ryr3	APN	2	112,910,397 (GRCm38)	missense	probably benign
IGL03166:Ryr3	APN	2	112,641,112 (GRCm38)	nonsense	probably null
IGL03177:Ryr3	APN	2	113,028,671 (GRCm38)	missense	probably benign	0.39
IGL03205:Ryr3	APN	2	112,632,142 (GRCm38)	missense	probably damaging	1.00
IGL03224:Ryr3	APN	2	112,954,336 (GRCm38)	nonsense	probably null
IGL03249:Ryr3	APN	2	112,640,656 (GRCm38)	missense	probably benign	0.32
IGL03370:Ryr3	APN	2	112,756,599 (GRCm38)	missense	possibly damaging	0.69
intruder	UTSW	2	112,672,246 (GRCm38)	nonsense	probably null
usurper	UTSW	2	112,800,022 (GRCm38)	missense	probably damaging	1.00
ANU74:Ryr3	UTSW	2	112,831,230 (GRCm38)	critical splice acceptor site	probably null
BB006:Ryr3	UTSW	2	112,834,188 (GRCm38)	missense	probably benign	0.00
BB016:Ryr3	UTSW	2	112,834,188 (GRCm38)	missense	probably benign	0.00
F5426:Ryr3	UTSW	2	112,766,338 (GRCm38)	splice site	probably benign
PIT4494001:Ryr3	UTSW	2	112,841,876 (GRCm38)	missense	probably damaging	0.99
R0022:Ryr3	UTSW	2	112,640,666 (GRCm38)	missense	probably damaging	1.00
R0022:Ryr3	UTSW	2	112,640,666 (GRCm38)	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112,869,075 (GRCm38)	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112,869,075 (GRCm38)	missense	probably damaging	1.00
R0085:Ryr3	UTSW	2	112,859,763 (GRCm38)	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112,800,055 (GRCm38)	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112,800,055 (GRCm38)	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112,901,031 (GRCm38)	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112,901,031 (GRCm38)	missense	probably damaging	1.00
R0116:Ryr3	UTSW	2	112,803,165 (GRCm38)	missense	probably damaging	0.99
R0281:Ryr3	UTSW	2	112,686,810 (GRCm38)	missense	probably damaging	1.00
R0302:Ryr3	UTSW	2	112,647,123 (GRCm38)	splice site	probably benign
R0306:Ryr3	UTSW	2	112,775,655 (GRCm38)	critical splice donor site	probably null
R0445:Ryr3	UTSW	2	112,866,054 (GRCm38)	missense	probably benign	0.16
R0463:Ryr3	UTSW	2	112,661,701 (GRCm38)	missense	probably damaging	1.00
R0592:Ryr3	UTSW	2	112,678,481 (GRCm38)	missense	probably damaging	1.00
R0622:Ryr3	UTSW	2	112,662,555 (GRCm38)	missense	probably damaging	1.00
R0656:Ryr3	UTSW	2	112,648,306 (GRCm38)	splice site	probably benign
R0735:Ryr3	UTSW	2	112,732,982 (GRCm38)	missense	probably benign	0.11
R0783:Ryr3	UTSW	2	112,756,327 (GRCm38)	splice site	probably benign
R0789:Ryr3	UTSW	2	112,780,973 (GRCm38)	splice site	probably null
R0835:Ryr3	UTSW	2	112,650,138 (GRCm38)	missense	probably benign	0.16
R0879:Ryr3	UTSW	2	113,030,243 (GRCm38)	missense	probably benign	0.02
R0924:Ryr3	UTSW	2	112,841,833 (GRCm38)	missense	probably damaging	1.00
R0930:Ryr3	UTSW	2	112,841,833 (GRCm38)	missense	probably damaging	1.00
R0931:Ryr3	UTSW	2	112,653,702 (GRCm38)	missense	probably damaging	1.00
R1037:Ryr3	UTSW	2	112,869,108 (GRCm38)	missense	probably benign	0.42
R1169:Ryr3	UTSW	2	112,733,014 (GRCm38)	missense	probably benign	0.01
R1170:Ryr3	UTSW	2	112,946,987 (GRCm38)	missense	probably damaging	1.00
R1178:Ryr3	UTSW	2	112,964,380 (GRCm38)	missense	probably benign	0.00
R1187:Ryr3	UTSW	2	112,958,176 (GRCm38)	missense	probably damaging	1.00
R1289:Ryr3	UTSW	2	112,645,285 (GRCm38)	missense	probably damaging	1.00
R1337:Ryr3	UTSW	2	112,779,963 (GRCm38)	missense	possibly damaging	0.46
R1342:Ryr3	UTSW	2	112,750,803 (GRCm38)	missense	probably damaging	1.00
R1349:Ryr3	UTSW	2	112,834,201 (GRCm38)	missense	probably damaging	1.00
R1372:Ryr3	UTSW	2	112,834,201 (GRCm38)	missense	probably damaging	1.00
R1434:Ryr3	UTSW	2	112,645,259 (GRCm38)	missense	probably damaging	1.00
R1438:Ryr3	UTSW	2	112,757,701 (GRCm38)	missense	probably benign	0.18
R1467:Ryr3	UTSW	2	112,753,002 (GRCm38)	splice site	probably benign
R1470:Ryr3	UTSW	2	112,653,007 (GRCm38)	missense	probably benign
R1470:Ryr3	UTSW	2	112,653,007 (GRCm38)	missense	probably benign
R1474:Ryr3	UTSW	2	112,909,962 (GRCm38)	missense	probably damaging	1.00
R1481:Ryr3	UTSW	2	112,636,522 (GRCm38)	splice site	probably benign
R1513:Ryr3	UTSW	2	112,709,197 (GRCm38)	nonsense	probably null
R1524:Ryr3	UTSW	2	112,869,082 (GRCm38)	missense	probably damaging	0.98
R1525:Ryr3	UTSW	2	112,678,090 (GRCm38)	missense	probably damaging	1.00
R1526:Ryr3	UTSW	2	112,661,657 (GRCm38)	missense	probably damaging	1.00
R1611:Ryr3	UTSW	2	112,653,505 (GRCm38)	missense	possibly damaging	0.72
R1640:Ryr3	UTSW	2	112,900,833 (GRCm38)	missense	probably damaging	1.00
R1662:Ryr3	UTSW	2	112,709,273 (GRCm38)	missense	probably damaging	0.99
R1764:Ryr3	UTSW	2	112,860,460 (GRCm38)	missense	probably damaging	1.00
R1769:Ryr3	UTSW	2	112,751,768 (GRCm38)	critical splice donor site	probably null
R1776:Ryr3	UTSW	2	112,957,253 (GRCm38)	missense	probably damaging	0.99
R1780:Ryr3	UTSW	2	112,867,292 (GRCm38)	missense	probably damaging	0.98
R1840:Ryr3	UTSW	2	112,750,820 (GRCm38)	missense	probably damaging	1.00
R1864:Ryr3	UTSW	2	112,730,328 (GRCm38)	missense	possibly damaging	0.65
R1872:Ryr3	UTSW	2	112,709,137 (GRCm38)	missense	possibly damaging	0.94
R1960:Ryr3	UTSW	2	112,794,467 (GRCm38)	missense	probably damaging	1.00
R1994:Ryr3	UTSW	2	112,654,492 (GRCm38)	missense	probably null	0.93
R2018:Ryr3	UTSW	2	112,781,065 (GRCm38)	missense	probably benign	0.24
R2019:Ryr3	UTSW	2	112,781,065 (GRCm38)	missense	probably benign	0.24
R2029:Ryr3	UTSW	2	112,647,016 (GRCm38)	missense	possibly damaging	0.82
R2051:Ryr3	UTSW	2	112,756,641 (GRCm38)	missense	probably damaging	1.00
R2060:Ryr3	UTSW	2	112,954,364 (GRCm38)	missense	possibly damaging	0.92
R2061:Ryr3	UTSW	2	112,663,004 (GRCm38)	missense	possibly damaging	0.83
R2067:Ryr3	UTSW	2	112,946,957 (GRCm38)	missense	probably damaging	1.00
R2106:Ryr3	UTSW	2	112,638,129 (GRCm38)	missense	probably damaging	1.00
R2129:Ryr3	UTSW	2	112,678,370 (GRCm38)	splice site	probably benign
R2140:Ryr3	UTSW	2	112,875,148 (GRCm38)	missense	probably benign	0.01
R2176:Ryr3	UTSW	2	112,666,335 (GRCm38)	missense	possibly damaging	0.48
R2241:Ryr3	UTSW	2	112,801,392 (GRCm38)	missense	probably damaging	1.00
R2261:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R2262:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R2276:Ryr3	UTSW	2	112,649,319 (GRCm38)	missense	possibly damaging	0.79
R2279:Ryr3	UTSW	2	112,649,319 (GRCm38)	missense	possibly damaging	0.79
R2403:Ryr3	UTSW	2	112,686,628 (GRCm38)	missense	probably damaging	1.00
R2510:Ryr3	UTSW	2	112,675,904 (GRCm38)	missense	probably benign	0.18
R2568:Ryr3	UTSW	2	112,675,874 (GRCm38)	missense	probably damaging	1.00
R3013:Ryr3	UTSW	2	112,640,281 (GRCm38)	missense	probably damaging	1.00
R3431:Ryr3	UTSW	2	112,656,531 (GRCm38)	missense	probably damaging	1.00
R3552:Ryr3	UTSW	2	112,751,787 (GRCm38)	missense	probably damaging	1.00
R3761:Ryr3	UTSW	2	112,754,913 (GRCm38)	missense	probably benign
R3909:Ryr3	UTSW	2	112,636,608 (GRCm38)	missense	probably damaging	1.00
R3923:Ryr3	UTSW	2	112,841,873 (GRCm38)	missense	possibly damaging	0.92
R3924:Ryr3	UTSW	2	113,028,703 (GRCm38)	splice site	probably benign
R3927:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R3947:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R3949:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R3976:Ryr3	UTSW	2	112,675,837 (GRCm38)	missense	possibly damaging	0.49
R4004:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R4022:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R4084:Ryr3	UTSW	2	112,900,908 (GRCm38)	missense	probably damaging	0.99
R4106:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R4108:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R4109:Ryr3	UTSW	2	112,675,873 (GRCm38)	missense	probably damaging	0.99
R4131:Ryr3	UTSW	2	112,926,983 (GRCm38)	splice site	probably null
R4156:Ryr3	UTSW	2	112,653,675 (GRCm38)	missense	probably damaging	1.00
R4172:Ryr3	UTSW	2	112,794,470 (GRCm38)	missense	probably damaging	1.00
R4234:Ryr3	UTSW	2	112,910,407 (GRCm38)	missense	probably damaging	1.00
R4399:Ryr3	UTSW	2	112,946,844 (GRCm38)	missense	probably benign	0.01
R4409:Ryr3	UTSW	2	112,730,308 (GRCm38)	missense	probably damaging	1.00
R4418:Ryr3	UTSW	2	112,831,224 (GRCm38)	missense	probably damaging	1.00
R4466:Ryr3	UTSW	2	112,653,102 (GRCm38)	missense	possibly damaging	0.92
R4525:Ryr3	UTSW	2	112,653,621 (GRCm38)	missense	probably damaging	0.98
R4573:Ryr3	UTSW	2	112,755,174 (GRCm38)	splice site	probably null
R4589:Ryr3	UTSW	2	112,875,133 (GRCm38)	missense	probably damaging	1.00
R4653:Ryr3	UTSW	2	112,652,763 (GRCm38)	missense	probably damaging	1.00
R4664:Ryr3	UTSW	2	112,996,555 (GRCm38)	intron	probably benign
R4710:Ryr3	UTSW	2	112,766,301 (GRCm38)	missense	probably damaging	1.00
R4734:Ryr3	UTSW	2	112,910,502 (GRCm38)	missense	probably damaging	0.99
R4741:Ryr3	UTSW	2	112,803,268 (GRCm38)	missense	probably damaging	0.99
R4748:Ryr3	UTSW	2	112,964,405 (GRCm38)	missense	possibly damaging	0.95
R4749:Ryr3	UTSW	2	112,964,405 (GRCm38)	missense	possibly damaging	0.95
R4754:Ryr3	UTSW	2	112,757,639 (GRCm38)	missense	possibly damaging	0.94
R4764:Ryr3	UTSW	2	112,733,031 (GRCm38)	critical splice acceptor site	probably null
R4812:Ryr3	UTSW	2	112,912,236 (GRCm38)	missense	probably damaging	1.00
R4822:Ryr3	UTSW	2	112,652,745 (GRCm38)	missense	probably damaging	1.00
R4841:Ryr3	UTSW	2	112,648,373 (GRCm38)	missense	probably damaging	1.00
R4849:Ryr3	UTSW	2	112,908,462 (GRCm38)	missense	probably damaging	1.00
R4917:Ryr3	UTSW	2	112,831,185 (GRCm38)	missense	probably damaging	1.00
R4942:Ryr3	UTSW	2	112,836,257 (GRCm38)	missense	probably damaging	0.99
R4990:Ryr3	UTSW	2	112,909,973 (GRCm38)	missense	probably damaging	1.00
R4990:Ryr3	UTSW	2	112,635,777 (GRCm38)	missense	probably damaging	1.00
R5049:Ryr3	UTSW	2	112,640,171 (GRCm38)	missense	probably damaging	1.00
R5055:Ryr3	UTSW	2	112,831,159 (GRCm38)	missense	probably benign	0.00
R5112:Ryr3	UTSW	2	112,902,665 (GRCm38)	missense	probably damaging	1.00
R5160:Ryr3	UTSW	2	112,646,927 (GRCm38)	missense	probably damaging	1.00
R5169:Ryr3	UTSW	2	112,670,660 (GRCm38)	missense	possibly damaging	0.63
R5176:Ryr3	UTSW	2	112,757,667 (GRCm38)	missense	possibly damaging	0.95
R5182:Ryr3	UTSW	2	112,755,150 (GRCm38)	missense	probably damaging	1.00
R5263:Ryr3	UTSW	2	112,718,002 (GRCm38)	missense	possibly damaging	0.65
R5272:Ryr3	UTSW	2	112,653,213 (GRCm38)	missense	probably damaging	1.00
R5332:Ryr3	UTSW	2	112,902,693 (GRCm38)	missense	probably damaging	1.00
R5340:Ryr3	UTSW	2	112,834,125 (GRCm38)	missense	probably damaging	0.99
R5359:Ryr3	UTSW	2	112,775,841 (GRCm38)	splice site	probably null
R5434:Ryr3	UTSW	2	112,794,469 (GRCm38)	missense	probably damaging	1.00
R5454:Ryr3	UTSW	2	112,730,302 (GRCm38)	splice site	probably null
R5501:Ryr3	UTSW	2	112,662,504 (GRCm38)	missense	possibly damaging	0.80
R5560:Ryr3	UTSW	2	112,754,877 (GRCm38)	missense	probably damaging	1.00
R5580:Ryr3	UTSW	2	112,841,948 (GRCm38)	missense	probably damaging	1.00
R5621:Ryr3	UTSW	2	112,900,984 (GRCm38)	nonsense	probably null
R5731:Ryr3	UTSW	2	112,641,572 (GRCm38)	missense	probably damaging	1.00
R5757:Ryr3	UTSW	2	112,841,975 (GRCm38)	missense	probably damaging	1.00
R5758:Ryr3	UTSW	2	112,841,975 (GRCm38)	missense	probably damaging	1.00
R5768:Ryr3	UTSW	2	112,753,097 (GRCm38)	missense	probably benign	0.05
R5783:Ryr3	UTSW	2	112,652,998 (GRCm38)	missense	probably benign	0.06
R5799:Ryr3	UTSW	2	112,686,580 (GRCm38)	missense	probably damaging	1.00
R5829:Ryr3	UTSW	2	112,859,731 (GRCm38)	missense	probably damaging	1.00
R5883:Ryr3	UTSW	2	113,030,292 (GRCm38)	intron	probably benign
R5911:Ryr3	UTSW	2	112,908,487 (GRCm38)	missense	probably damaging	1.00
R5968:Ryr3	UTSW	2	112,647,049 (GRCm38)	missense	probably benign	0.22
R5972:Ryr3	UTSW	2	112,834,064 (GRCm38)	missense	probably damaging	0.99
R5978:Ryr3	UTSW	2	112,672,269 (GRCm38)	missense	probably benign	0.00
R6084:Ryr3	UTSW	2	112,908,493 (GRCm38)	missense	probably damaging	1.00
R6117:Ryr3	UTSW	2	112,635,396 (GRCm38)	missense	probably damaging	1.00
R6126:Ryr3	UTSW	2	112,757,670 (GRCm38)	missense	probably damaging	1.00
R6128:Ryr3	UTSW	2	112,954,294 (GRCm38)	critical splice donor site	probably null
R6157:Ryr3	UTSW	2	112,841,899 (GRCm38)	missense	probably damaging	0.98
R6258:Ryr3	UTSW	2	112,660,104 (GRCm38)	missense	probably damaging	1.00
R6260:Ryr3	UTSW	2	112,660,104 (GRCm38)	missense	probably damaging	1.00
R6373:Ryr3	UTSW	2	112,656,544 (GRCm38)	missense	probably damaging	1.00
R6377:Ryr3	UTSW	2	112,632,185 (GRCm38)	missense	probably damaging	1.00
R6443:Ryr3	UTSW	2	112,675,933 (GRCm38)	missense	possibly damaging	0.88
R6478:Ryr3	UTSW	2	112,660,068 (GRCm38)	missense	probably damaging	1.00
R6512:Ryr3	UTSW	2	112,867,378 (GRCm38)	missense	possibly damaging	0.83
R6684:Ryr3	UTSW	2	112,753,088 (GRCm38)	missense	probably damaging	1.00
R6753:Ryr3	UTSW	2	112,652,610 (GRCm38)	missense	probably damaging	0.99
R6812:Ryr3	UTSW	2	112,946,906 (GRCm38)	missense	probably damaging	1.00
R6910:Ryr3	UTSW	2	112,958,175 (GRCm38)	missense	probably damaging	1.00
R6930:Ryr3	UTSW	2	112,860,354 (GRCm38)	missense	probably damaging	1.00
R6946:Ryr3	UTSW	2	112,831,200 (GRCm38)	missense	probably damaging	1.00
R6950:Ryr3	UTSW	2	112,686,825 (GRCm38)	missense	possibly damaging	0.78
R6973:Ryr3	UTSW	2	112,766,311 (GRCm38)	missense	probably damaging	0.99
R6984:Ryr3	UTSW	2	112,875,091 (GRCm38)	missense	probably damaging	1.00
R7020:Ryr3	UTSW	2	112,753,078 (GRCm38)	missense	probably benign	0.00
R7037:Ryr3	UTSW	2	112,949,130 (GRCm38)	nonsense	probably null
R7166:Ryr3	UTSW	2	112,875,028 (GRCm38)	missense	probably damaging	1.00
R7172:Ryr3	UTSW	2	112,661,657 (GRCm38)	missense	probably damaging	1.00
R7177:Ryr3	UTSW	2	112,900,843 (GRCm38)	missense	probably damaging	1.00
R7188:Ryr3	UTSW	2	113,028,644 (GRCm38)	missense	probably damaging	1.00
R7202:Ryr3	UTSW	2	112,766,319 (GRCm38)	missense	probably damaging	1.00
R7228:Ryr3	UTSW	2	112,861,852 (GRCm38)	missense	probably damaging	1.00
R7256:Ryr3	UTSW	2	112,672,246 (GRCm38)	nonsense	probably null
R7293:Ryr3	UTSW	2	112,902,603 (GRCm38)	missense	probably benign	0.13
R7331:Ryr3	UTSW	2	112,763,665 (GRCm38)	missense	possibly damaging	0.80
R7380:Ryr3	UTSW	2	112,640,157 (GRCm38)	missense	probably damaging	1.00
R7391:Ryr3	UTSW	2	112,780,977 (GRCm38)	critical splice donor site	probably null
R7455:Ryr3	UTSW	2	112,728,866 (GRCm38)	missense	probably damaging	0.99
R7466:Ryr3	UTSW	2	112,926,957 (GRCm38)	missense	probably benign	0.40
R7481:Ryr3	UTSW	2	112,678,094 (GRCm38)	missense	possibly damaging	0.95
R7481:Ryr3	UTSW	2	112,678,093 (GRCm38)	missense	probably benign	0.16
R7497:Ryr3	UTSW	2	112,730,473 (GRCm38)	missense	probably benign	0.06
R7502:Ryr3	UTSW	2	112,712,361 (GRCm38)	missense	probably benign	0.00
R7505:Ryr3	UTSW	2	112,712,429 (GRCm38)	missense	probably damaging	0.99
R7581:Ryr3	UTSW	2	112,753,027 (GRCm38)	missense	probably damaging	0.99
R7606:Ryr3	UTSW	2	112,645,245 (GRCm38)	nonsense	probably null
R7677:Ryr3	UTSW	2	112,833,900 (GRCm38)	missense	probably benign
R7703:Ryr3	UTSW	2	112,859,765 (GRCm38)	missense	probably damaging	1.00
R7713:Ryr3	UTSW	2	112,635,346 (GRCm38)	missense	probably benign	0.12
R7784:Ryr3	UTSW	2	112,775,695 (GRCm38)	missense	probably damaging	1.00
R7831:Ryr3	UTSW	2	112,926,838 (GRCm38)	missense	possibly damaging	0.92
R7851:Ryr3	UTSW	2	112,678,517 (GRCm38)	missense	probably benign	0.05
R7873:Ryr3	UTSW	2	112,730,428 (GRCm38)	missense	probably benign	0.28
R7890:Ryr3	UTSW	2	112,926,912 (GRCm38)	missense	probably damaging	1.00
R7899:Ryr3	UTSW	2	112,646,950 (GRCm38)	missense	possibly damaging	0.86
R7904:Ryr3	UTSW	2	112,781,024 (GRCm38)	missense	probably damaging	1.00
R7929:Ryr3	UTSW	2	112,834,188 (GRCm38)	missense	probably benign	0.00
R7982:Ryr3	UTSW	2	112,669,249 (GRCm38)	small deletion	probably benign
R8018:Ryr3	UTSW	2	112,678,432 (GRCm38)	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112,875,077 (GRCm38)	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112,775,664 (GRCm38)	missense	probably damaging	1.00
R8095:Ryr3	UTSW	2	112,668,043 (GRCm38)	critical splice donor site	probably null
R8097:Ryr3	UTSW	2	112,670,270 (GRCm38)	splice site	probably null
R8181:Ryr3	UTSW	2	112,778,243 (GRCm38)	missense	probably damaging	0.98
R8276:Ryr3	UTSW	2	112,640,617 (GRCm38)	missense	probably damaging	1.00
R8329:Ryr3	UTSW	2	112,662,510 (GRCm38)	missense	possibly damaging	0.94
R8345:Ryr3	UTSW	2	112,652,925 (GRCm38)	missense	probably benign	0.01
R8361:Ryr3	UTSW	2	112,653,130 (GRCm38)	missense	probably damaging	0.98
R8421:Ryr3	UTSW	2	112,996,584 (GRCm38)	missense	probably benign	0.00
R8424:Ryr3	UTSW	2	112,841,894 (GRCm38)	missense	possibly damaging	0.91
R8471:Ryr3	UTSW	2	112,653,780 (GRCm38)	missense	probably damaging	1.00
R8505:Ryr3	UTSW	2	112,675,870 (GRCm38)	missense	probably damaging	0.98
R8535:Ryr3	UTSW	2	112,949,088 (GRCm38)	critical splice donor site	probably null
R8540:Ryr3	UTSW	2	112,800,022 (GRCm38)	missense	probably damaging	1.00
R8722:Ryr3	UTSW	2	112,772,771 (GRCm38)	missense	probably benign	0.12
R8818:Ryr3	UTSW	2	112,831,096 (GRCm38)	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112,859,724 (GRCm38)	missense	probably benign	0.01
R8819:Ryr3	UTSW	2	112,635,792 (GRCm38)	missense	probably damaging	1.00
R8820:Ryr3	UTSW	2	112,859,724 (GRCm38)	missense	probably benign	0.01
R8820:Ryr3	UTSW	2	112,635,792 (GRCm38)	missense	probably damaging	1.00
R8852:Ryr3	UTSW	2	112,794,499 (GRCm38)	missense	probably damaging	1.00
R8859:Ryr3	UTSW	2	112,653,219 (GRCm38)	missense	probably damaging	0.98
R8896:Ryr3	UTSW	2	112,753,050 (GRCm38)	nonsense	probably null
R8916:Ryr3	UTSW	2	112,778,290 (GRCm38)	missense	probably damaging	1.00
R8935:Ryr3	UTSW	2	112,678,057 (GRCm38)	missense	probably benign	0.33
R8943:Ryr3	UTSW	2	112,635,324 (GRCm38)	missense	probably damaging	1.00
R8963:Ryr3	UTSW	2	112,836,670 (GRCm38)	critical splice donor site	probably null
R8974:Ryr3	UTSW	2	112,912,279 (GRCm38)	missense	possibly damaging	0.74
R9008:Ryr3	UTSW	2	112,635,403 (GRCm38)	missense	probably damaging	0.98
R9040:Ryr3	UTSW	2	112,954,386 (GRCm38)	missense	probably damaging	1.00
R9041:Ryr3	UTSW	2	112,957,201 (GRCm38)	missense	probably damaging	0.97
R9102:Ryr3	UTSW	2	112,678,561 (GRCm38)	splice site	probably benign
R9167:Ryr3	UTSW	2	112,834,053 (GRCm38)	missense	probably damaging	1.00
R9180:Ryr3	UTSW	2	112,661,636 (GRCm38)	missense	probably damaging	0.99
R9219:Ryr3	UTSW	2	112,912,239 (GRCm38)	missense	possibly damaging	0.62
R9258:Ryr3	UTSW	2	112,653,019 (GRCm38)	missense	probably damaging	0.99
R9300:Ryr3	UTSW	2	112,860,350 (GRCm38)	missense	probably benign
R9320:Ryr3	UTSW	2	112,779,991 (GRCm38)	missense	probably damaging	1.00
R9325:Ryr3	UTSW	2	112,649,295 (GRCm38)	missense	probably damaging	0.96
R9405:Ryr3	UTSW	2	112,834,267 (GRCm38)	missense	probably damaging	1.00
R9414:Ryr3	UTSW	2	112,670,666 (GRCm38)	missense	possibly damaging	0.81
R9489:Ryr3	UTSW	2	112,661,621 (GRCm38)	missense	probably damaging	1.00
R9522:Ryr3	UTSW	2	112,730,414 (GRCm38)	missense	probably benign	0.34
R9526:Ryr3	UTSW	2	112,833,925 (GRCm38)	missense	probably benign
R9529:Ryr3	UTSW	2	112,635,315 (GRCm38)	missense	possibly damaging	0.70
R9605:Ryr3	UTSW	2	112,661,621 (GRCm38)	missense	probably damaging	1.00
R9652:Ryr3	UTSW	2	112,804,702 (GRCm38)	missense	possibly damaging	0.66
R9660:Ryr3	UTSW	2	112,833,729 (GRCm38)	missense	probably benign
R9670:Ryr3	UTSW	2	112,730,500 (GRCm38)	missense	probably benign	0.28
R9673:Ryr3	UTSW	2	112,656,538 (GRCm38)	missense	possibly damaging	0.93
R9710:Ryr3	UTSW	2	112,803,189 (GRCm38)	missense	probably damaging	0.99
R9741:Ryr3	UTSW	2	112,646,926 (GRCm38)	missense	probably benign	0.00
R9772:Ryr3	UTSW	2	112,826,703 (GRCm38)	missense	probably damaging	0.96
RF010:Ryr3	UTSW	2	112,775,670 (GRCm38)	missense	probably damaging	0.97
RF040:Ryr3	UTSW	2	112,910,524 (GRCm38)	critical splice acceptor site	probably benign
RF044:Ryr3	UTSW	2	112,910,524 (GRCm38)	critical splice acceptor site	probably benign
X0057:Ryr3	UTSW	2	112,640,159 (GRCm38)	missense	probably damaging	1.00
X0064:Ryr3	UTSW	2	112,912,302 (GRCm38)	missense	probably benign	0.26
Z1088:Ryr3	UTSW	2	112,900,916 (GRCm38)	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112,728,924 (GRCm38)	missense	probably benign	0.01
Z1176:Ryr3	UTSW	2	112,712,374 (GRCm38)	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112,675,920 (GRCm38)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCACTGTCATGGTGATCCC -3'
(R):5'- AAACTTTCAGTGTGTGCTTCTTCAC -3'

Sequencing Primer
(F):5'- TGGTGATCCCAGTTTCCTTAAAG -3'
(R):5'- GTGCTTCTTCACAAAAATGAGCC -3'

Posted On

2016-07-22