Incidental Mutation 'R5206:Ryr3'
ID 402018
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Name ryanodine receptor 3
Synonyms calcium release channel isoform 3
MMRRC Submission 042781-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R5206 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 112631355-113217096 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112844711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1352 (Y1352C)
Ref Sequence ENSEMBL: ENSMUSP00000146449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080673
AA Change: Y1352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: Y1352C

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091818
AA Change: Y1372C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: Y1372C

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134358
AA Change: Y1352C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208151
AA Change: Y1352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208290
AA Change: Y1352C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 (GRCm38) E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 (GRCm38) K571* probably null Het
A2m T C 6: 121,674,807 (GRCm38) V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 (GRCm38) V801A probably damaging Het
Acod1 T A 14: 103,055,295 (GRCm38) D418E possibly damaging Het
Bsn G A 9: 108,105,373 (GRCm38) A3727V unknown Het
Cmah T G 13: 24,464,284 (GRCm38) F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 (GRCm38) I173L probably benign Het
Dnah12 T C 14: 26,769,985 (GRCm38) W1126R probably damaging Het
Dock5 G T 14: 67,763,184 (GRCm38) A1690E probably benign Het
Dop1b T C 16: 93,801,584 (GRCm38) L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 (GRCm38) D55E probably benign Het
Fam83f G A 15: 80,692,054 (GRCm38) G302D possibly damaging Het
Fus G A 7: 127,969,797 (GRCm38) G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 (GRCm38) probably benign Het
Gxylt2 T C 6: 100,804,615 (GRCm38) V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 (GRCm38) R255H probably damaging Het
Ints8 A T 4: 11,216,477 (GRCm38) I838N possibly damaging Het
Lama5 C A 2: 180,191,304 (GRCm38) C1579F probably damaging Het
Med13 C T 11: 86,319,879 (GRCm38) R479H probably damaging Het
Or51ag1 A T 7: 103,506,102 (GRCm38) Y281* probably null Het
Or5b113 G T 19: 13,365,065 (GRCm38) G146C possibly damaging Het
Or5k15 G T 16: 58,890,018 (GRCm38) N67K probably damaging Het
Or6e1 T A 14: 54,282,698 (GRCm38) M66L probably benign Het
Or9g3 T A 2: 85,759,623 (GRCm38) Y251F probably benign Het
Pak6 A G 2: 118,693,303 (GRCm38) E313G probably benign Het
Pigs T A 11: 78,333,723 (GRCm38) Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 (GRCm38) D165V probably benign Het
Plbd1 C T 6: 136,641,156 (GRCm38) V133M probably benign Het
Ppp1r14bl C T 1: 23,102,102 (GRCm38) G44R probably benign Het
Scamp1 C T 13: 94,232,107 (GRCm38) R51H probably damaging Het
Skic3 G A 13: 76,147,767 (GRCm38) E1050K possibly damaging Het
Slc2a2 G A 3: 28,708,607 (GRCm38) V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 (GRCm38) A1062P probably damaging Het
Snai1 T C 2: 167,538,968 (GRCm38) I127T probably benign Het
Stat4 G A 1: 52,105,236 (GRCm38) G692D probably damaging Het
Stc1 A T 14: 69,031,599 (GRCm38) D72V probably damaging Het
Tmc1 T C 19: 20,826,660 (GRCm38) N351S probably damaging Het
Trim28 A G 7: 13,025,348 (GRCm38) I130V probably benign Het
Trim39 A G 17: 36,260,490 (GRCm38) Y459H probably damaging Het
Ugt1a6b C A 1: 88,107,448 (GRCm38) Y169* probably null Het
Vasp T C 7: 19,258,855 (GRCm38) probably benign Het
Vmn2r99 G T 17: 19,378,606 (GRCm38) G184V probably benign Het
Xrcc1 C T 7: 24,567,563 (GRCm38) T358I probably damaging Het
Zfp219 A G 14: 52,009,565 (GRCm38) V35A probably benign Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112,660,149 (GRCm38) missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112,663,012 (GRCm38) splice site probably benign
IGL00785:Ryr3 APN 2 112,836,103 (GRCm38) missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112,886,589 (GRCm38) missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112,728,934 (GRCm38) splice site probably benign
IGL00970:Ryr3 APN 2 112,764,676 (GRCm38) missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112,751,846 (GRCm38) splice site probably benign
IGL01105:Ryr3 APN 2 112,751,805 (GRCm38) missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112,709,073 (GRCm38) missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112,660,054 (GRCm38) missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112,672,248 (GRCm38) missense probably benign 0.20
IGL01552:Ryr3 APN 2 112,825,883 (GRCm38) missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112,772,728 (GRCm38) missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112,650,111 (GRCm38) critical splice donor site probably null
IGL01837:Ryr3 APN 2 112,801,320 (GRCm38) missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112,803,158 (GRCm38) splice site probably benign
IGL01907:Ryr3 APN 2 112,869,001 (GRCm38) splice site probably benign
IGL02005:Ryr3 APN 2 112,663,263 (GRCm38) splice site probably benign
IGL02014:Ryr3 APN 2 112,946,915 (GRCm38) missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112,949,157 (GRCm38) missense probably benign
IGL02178:Ryr3 APN 2 112,825,799 (GRCm38) missense probably benign 0.17
IGL02185:Ryr3 APN 2 112,967,203 (GRCm38) missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112,754,838 (GRCm38) splice site probably benign
IGL02200:Ryr3 APN 2 112,849,510 (GRCm38) missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112,964,356 (GRCm38) missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112,645,277 (GRCm38) missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112,834,114 (GRCm38) missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112,847,399 (GRCm38) critical splice donor site probably null
IGL02340:Ryr3 APN 2 112,947,004 (GRCm38) splice site probably benign
IGL02398:Ryr3 APN 2 112,847,422 (GRCm38) missense probably benign 0.05
IGL02407:Ryr3 APN 2 112,754,958 (GRCm38) missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112,900,905 (GRCm38) missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112,833,990 (GRCm38) missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112,681,728 (GRCm38) splice site probably benign
IGL02585:Ryr3 APN 2 112,712,303 (GRCm38) missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112,902,576 (GRCm38) critical splice donor site probably null
IGL02817:Ryr3 APN 2 112,844,623 (GRCm38) critical splice donor site probably null
IGL02861:Ryr3 APN 2 112,652,841 (GRCm38) missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112,668,120 (GRCm38) missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112,800,047 (GRCm38) missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112,675,974 (GRCm38) splice site probably benign
IGL03137:Ryr3 APN 2 112,910,397 (GRCm38) missense probably benign
IGL03166:Ryr3 APN 2 112,641,112 (GRCm38) nonsense probably null
IGL03177:Ryr3 APN 2 113,028,671 (GRCm38) missense probably benign 0.39
IGL03205:Ryr3 APN 2 112,632,142 (GRCm38) missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112,954,336 (GRCm38) nonsense probably null
IGL03249:Ryr3 APN 2 112,640,656 (GRCm38) missense probably benign 0.32
IGL03370:Ryr3 APN 2 112,756,599 (GRCm38) missense possibly damaging 0.69
intruder UTSW 2 112,672,246 (GRCm38) nonsense probably null
usurper UTSW 2 112,800,022 (GRCm38) missense probably damaging 1.00
ANU74:Ryr3 UTSW 2 112,831,230 (GRCm38) critical splice acceptor site probably null
BB006:Ryr3 UTSW 2 112,834,188 (GRCm38) missense probably benign 0.00
BB016:Ryr3 UTSW 2 112,834,188 (GRCm38) missense probably benign 0.00
F5426:Ryr3 UTSW 2 112,766,338 (GRCm38) splice site probably benign
PIT4494001:Ryr3 UTSW 2 112,841,876 (GRCm38) missense probably damaging 0.99
R0022:Ryr3 UTSW 2 112,640,666 (GRCm38) missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112,640,666 (GRCm38) missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112,869,075 (GRCm38) missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112,869,075 (GRCm38) missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112,859,763 (GRCm38) missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112,800,055 (GRCm38) missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112,800,055 (GRCm38) missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112,901,031 (GRCm38) missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112,901,031 (GRCm38) missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112,803,165 (GRCm38) missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112,686,810 (GRCm38) missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112,647,123 (GRCm38) splice site probably benign
R0306:Ryr3 UTSW 2 112,775,655 (GRCm38) critical splice donor site probably null
R0445:Ryr3 UTSW 2 112,866,054 (GRCm38) missense probably benign 0.16
R0463:Ryr3 UTSW 2 112,661,701 (GRCm38) missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112,678,481 (GRCm38) missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112,662,555 (GRCm38) missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112,648,306 (GRCm38) splice site probably benign
R0735:Ryr3 UTSW 2 112,732,982 (GRCm38) missense probably benign 0.11
R0783:Ryr3 UTSW 2 112,756,327 (GRCm38) splice site probably benign
R0789:Ryr3 UTSW 2 112,780,973 (GRCm38) splice site probably null
R0835:Ryr3 UTSW 2 112,650,138 (GRCm38) missense probably benign 0.16
R0879:Ryr3 UTSW 2 113,030,243 (GRCm38) missense probably benign 0.02
R0924:Ryr3 UTSW 2 112,841,833 (GRCm38) missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112,841,833 (GRCm38) missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112,653,702 (GRCm38) missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112,869,108 (GRCm38) missense probably benign 0.42
R1169:Ryr3 UTSW 2 112,733,014 (GRCm38) missense probably benign 0.01
R1170:Ryr3 UTSW 2 112,946,987 (GRCm38) missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112,964,380 (GRCm38) missense probably benign 0.00
R1187:Ryr3 UTSW 2 112,958,176 (GRCm38) missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112,645,285 (GRCm38) missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112,779,963 (GRCm38) missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112,750,803 (GRCm38) missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112,834,201 (GRCm38) missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112,834,201 (GRCm38) missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112,645,259 (GRCm38) missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112,757,701 (GRCm38) missense probably benign 0.18
R1467:Ryr3 UTSW 2 112,753,002 (GRCm38) splice site probably benign
R1470:Ryr3 UTSW 2 112,653,007 (GRCm38) missense probably benign
R1470:Ryr3 UTSW 2 112,653,007 (GRCm38) missense probably benign
R1474:Ryr3 UTSW 2 112,909,962 (GRCm38) missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112,636,522 (GRCm38) splice site probably benign
R1513:Ryr3 UTSW 2 112,709,197 (GRCm38) nonsense probably null
R1524:Ryr3 UTSW 2 112,869,082 (GRCm38) missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112,678,090 (GRCm38) missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112,661,657 (GRCm38) missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112,653,505 (GRCm38) missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112,900,833 (GRCm38) missense probably damaging 1.00
R1662:Ryr3 UTSW 2 112,709,273 (GRCm38) missense probably damaging 0.99
R1764:Ryr3 UTSW 2 112,860,460 (GRCm38) missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112,751,768 (GRCm38) critical splice donor site probably null
R1776:Ryr3 UTSW 2 112,957,253 (GRCm38) missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112,867,292 (GRCm38) missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112,750,820 (GRCm38) missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112,730,328 (GRCm38) missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112,709,137 (GRCm38) missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112,794,467 (GRCm38) missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112,654,492 (GRCm38) missense probably null 0.93
R2018:Ryr3 UTSW 2 112,781,065 (GRCm38) missense probably benign 0.24
R2019:Ryr3 UTSW 2 112,781,065 (GRCm38) missense probably benign 0.24
R2029:Ryr3 UTSW 2 112,647,016 (GRCm38) missense possibly damaging 0.82
R2051:Ryr3 UTSW 2 112,756,641 (GRCm38) missense probably damaging 1.00
R2060:Ryr3 UTSW 2 112,954,364 (GRCm38) missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112,663,004 (GRCm38) missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112,946,957 (GRCm38) missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112,638,129 (GRCm38) missense probably damaging 1.00
R2129:Ryr3 UTSW 2 112,678,370 (GRCm38) splice site probably benign
R2140:Ryr3 UTSW 2 112,875,148 (GRCm38) missense probably benign 0.01
R2176:Ryr3 UTSW 2 112,666,335 (GRCm38) missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112,801,392 (GRCm38) missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112,649,319 (GRCm38) missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112,649,319 (GRCm38) missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112,686,628 (GRCm38) missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112,675,904 (GRCm38) missense probably benign 0.18
R2568:Ryr3 UTSW 2 112,675,874 (GRCm38) missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112,640,281 (GRCm38) missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112,656,531 (GRCm38) missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112,751,787 (GRCm38) missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112,754,913 (GRCm38) missense probably benign
R3909:Ryr3 UTSW 2 112,636,608 (GRCm38) missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112,841,873 (GRCm38) missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 113,028,703 (GRCm38) splice site probably benign
R3927:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112,675,837 (GRCm38) missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112,900,908 (GRCm38) missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112,675,873 (GRCm38) missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112,926,983 (GRCm38) splice site probably null
R4156:Ryr3 UTSW 2 112,653,675 (GRCm38) missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112,794,470 (GRCm38) missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112,910,407 (GRCm38) missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112,946,844 (GRCm38) missense probably benign 0.01
R4409:Ryr3 UTSW 2 112,730,308 (GRCm38) missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112,831,224 (GRCm38) missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112,653,102 (GRCm38) missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112,653,621 (GRCm38) missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112,755,174 (GRCm38) splice site probably null
R4589:Ryr3 UTSW 2 112,875,133 (GRCm38) missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112,652,763 (GRCm38) missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112,996,555 (GRCm38) intron probably benign
R4710:Ryr3 UTSW 2 112,766,301 (GRCm38) missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112,910,502 (GRCm38) missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112,803,268 (GRCm38) missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112,964,405 (GRCm38) missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112,964,405 (GRCm38) missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112,757,639 (GRCm38) missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112,733,031 (GRCm38) critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112,912,236 (GRCm38) missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112,652,745 (GRCm38) missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112,648,373 (GRCm38) missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112,908,462 (GRCm38) missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112,831,185 (GRCm38) missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112,836,257 (GRCm38) missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112,909,973 (GRCm38) missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112,635,777 (GRCm38) missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112,640,171 (GRCm38) missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112,831,159 (GRCm38) missense probably benign 0.00
R5112:Ryr3 UTSW 2 112,902,665 (GRCm38) missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112,646,927 (GRCm38) missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112,670,660 (GRCm38) missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112,757,667 (GRCm38) missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112,755,150 (GRCm38) missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112,718,002 (GRCm38) missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112,653,213 (GRCm38) missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112,902,693 (GRCm38) missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112,834,125 (GRCm38) missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112,775,841 (GRCm38) splice site probably null
R5434:Ryr3 UTSW 2 112,794,469 (GRCm38) missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112,730,302 (GRCm38) splice site probably null
R5501:Ryr3 UTSW 2 112,662,504 (GRCm38) missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112,754,877 (GRCm38) missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112,841,948 (GRCm38) missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112,900,984 (GRCm38) nonsense probably null
R5731:Ryr3 UTSW 2 112,641,572 (GRCm38) missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112,841,975 (GRCm38) missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112,841,975 (GRCm38) missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112,753,097 (GRCm38) missense probably benign 0.05
R5783:Ryr3 UTSW 2 112,652,998 (GRCm38) missense probably benign 0.06
R5799:Ryr3 UTSW 2 112,686,580 (GRCm38) missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112,859,731 (GRCm38) missense probably damaging 1.00
R5883:Ryr3 UTSW 2 113,030,292 (GRCm38) intron probably benign
R5911:Ryr3 UTSW 2 112,908,487 (GRCm38) missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112,647,049 (GRCm38) missense probably benign 0.22
R5972:Ryr3 UTSW 2 112,834,064 (GRCm38) missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112,672,269 (GRCm38) missense probably benign 0.00
R6084:Ryr3 UTSW 2 112,908,493 (GRCm38) missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112,635,396 (GRCm38) missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112,757,670 (GRCm38) missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112,954,294 (GRCm38) critical splice donor site probably null
R6157:Ryr3 UTSW 2 112,841,899 (GRCm38) missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112,660,104 (GRCm38) missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112,660,104 (GRCm38) missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112,656,544 (GRCm38) missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112,632,185 (GRCm38) missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112,675,933 (GRCm38) missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112,660,068 (GRCm38) missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112,867,378 (GRCm38) missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112,753,088 (GRCm38) missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112,652,610 (GRCm38) missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112,946,906 (GRCm38) missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112,958,175 (GRCm38) missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112,860,354 (GRCm38) missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112,831,200 (GRCm38) missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112,686,825 (GRCm38) missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112,766,311 (GRCm38) missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112,875,091 (GRCm38) missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112,753,078 (GRCm38) missense probably benign 0.00
R7037:Ryr3 UTSW 2 112,949,130 (GRCm38) nonsense probably null
R7166:Ryr3 UTSW 2 112,875,028 (GRCm38) missense probably damaging 1.00
R7172:Ryr3 UTSW 2 112,661,657 (GRCm38) missense probably damaging 1.00
R7177:Ryr3 UTSW 2 112,900,843 (GRCm38) missense probably damaging 1.00
R7188:Ryr3 UTSW 2 113,028,644 (GRCm38) missense probably damaging 1.00
R7202:Ryr3 UTSW 2 112,766,319 (GRCm38) missense probably damaging 1.00
R7228:Ryr3 UTSW 2 112,861,852 (GRCm38) missense probably damaging 1.00
R7256:Ryr3 UTSW 2 112,672,246 (GRCm38) nonsense probably null
R7293:Ryr3 UTSW 2 112,902,603 (GRCm38) missense probably benign 0.13
R7331:Ryr3 UTSW 2 112,763,665 (GRCm38) missense possibly damaging 0.80
R7380:Ryr3 UTSW 2 112,640,157 (GRCm38) missense probably damaging 1.00
R7391:Ryr3 UTSW 2 112,780,977 (GRCm38) critical splice donor site probably null
R7455:Ryr3 UTSW 2 112,728,866 (GRCm38) missense probably damaging 0.99
R7466:Ryr3 UTSW 2 112,926,957 (GRCm38) missense probably benign 0.40
R7481:Ryr3 UTSW 2 112,678,094 (GRCm38) missense possibly damaging 0.95
R7481:Ryr3 UTSW 2 112,678,093 (GRCm38) missense probably benign 0.16
R7497:Ryr3 UTSW 2 112,730,473 (GRCm38) missense probably benign 0.06
R7502:Ryr3 UTSW 2 112,712,361 (GRCm38) missense probably benign 0.00
R7505:Ryr3 UTSW 2 112,712,429 (GRCm38) missense probably damaging 0.99
R7581:Ryr3 UTSW 2 112,753,027 (GRCm38) missense probably damaging 0.99
R7606:Ryr3 UTSW 2 112,645,245 (GRCm38) nonsense probably null
R7677:Ryr3 UTSW 2 112,833,900 (GRCm38) missense probably benign
R7703:Ryr3 UTSW 2 112,859,765 (GRCm38) missense probably damaging 1.00
R7713:Ryr3 UTSW 2 112,635,346 (GRCm38) missense probably benign 0.12
R7784:Ryr3 UTSW 2 112,775,695 (GRCm38) missense probably damaging 1.00
R7831:Ryr3 UTSW 2 112,926,838 (GRCm38) missense possibly damaging 0.92
R7851:Ryr3 UTSW 2 112,678,517 (GRCm38) missense probably benign 0.05
R7873:Ryr3 UTSW 2 112,730,428 (GRCm38) missense probably benign 0.28
R7890:Ryr3 UTSW 2 112,926,912 (GRCm38) missense probably damaging 1.00
R7899:Ryr3 UTSW 2 112,646,950 (GRCm38) missense possibly damaging 0.86
R7904:Ryr3 UTSW 2 112,781,024 (GRCm38) missense probably damaging 1.00
R7929:Ryr3 UTSW 2 112,834,188 (GRCm38) missense probably benign 0.00
R7982:Ryr3 UTSW 2 112,669,249 (GRCm38) small deletion probably benign
R8018:Ryr3 UTSW 2 112,678,432 (GRCm38) missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112,875,077 (GRCm38) missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112,775,664 (GRCm38) missense probably damaging 1.00
R8095:Ryr3 UTSW 2 112,668,043 (GRCm38) critical splice donor site probably null
R8097:Ryr3 UTSW 2 112,670,270 (GRCm38) splice site probably null
R8181:Ryr3 UTSW 2 112,778,243 (GRCm38) missense probably damaging 0.98
R8276:Ryr3 UTSW 2 112,640,617 (GRCm38) missense probably damaging 1.00
R8329:Ryr3 UTSW 2 112,662,510 (GRCm38) missense possibly damaging 0.94
R8345:Ryr3 UTSW 2 112,652,925 (GRCm38) missense probably benign 0.01
R8361:Ryr3 UTSW 2 112,653,130 (GRCm38) missense probably damaging 0.98
R8421:Ryr3 UTSW 2 112,996,584 (GRCm38) missense probably benign 0.00
R8424:Ryr3 UTSW 2 112,841,894 (GRCm38) missense possibly damaging 0.91
R8471:Ryr3 UTSW 2 112,653,780 (GRCm38) missense probably damaging 1.00
R8505:Ryr3 UTSW 2 112,675,870 (GRCm38) missense probably damaging 0.98
R8535:Ryr3 UTSW 2 112,949,088 (GRCm38) critical splice donor site probably null
R8540:Ryr3 UTSW 2 112,800,022 (GRCm38) missense probably damaging 1.00
R8722:Ryr3 UTSW 2 112,772,771 (GRCm38) missense probably benign 0.12
R8818:Ryr3 UTSW 2 112,831,096 (GRCm38) missense probably damaging 1.00
R8819:Ryr3 UTSW 2 112,859,724 (GRCm38) missense probably benign 0.01
R8819:Ryr3 UTSW 2 112,635,792 (GRCm38) missense probably damaging 1.00
R8820:Ryr3 UTSW 2 112,859,724 (GRCm38) missense probably benign 0.01
R8820:Ryr3 UTSW 2 112,635,792 (GRCm38) missense probably damaging 1.00
R8852:Ryr3 UTSW 2 112,794,499 (GRCm38) missense probably damaging 1.00
R8859:Ryr3 UTSW 2 112,653,219 (GRCm38) missense probably damaging 0.98
R8896:Ryr3 UTSW 2 112,753,050 (GRCm38) nonsense probably null
R8916:Ryr3 UTSW 2 112,778,290 (GRCm38) missense probably damaging 1.00
R8935:Ryr3 UTSW 2 112,678,057 (GRCm38) missense probably benign 0.33
R8943:Ryr3 UTSW 2 112,635,324 (GRCm38) missense probably damaging 1.00
R8963:Ryr3 UTSW 2 112,836,670 (GRCm38) critical splice donor site probably null
R8974:Ryr3 UTSW 2 112,912,279 (GRCm38) missense possibly damaging 0.74
R9008:Ryr3 UTSW 2 112,635,403 (GRCm38) missense probably damaging 0.98
R9040:Ryr3 UTSW 2 112,954,386 (GRCm38) missense probably damaging 1.00
R9041:Ryr3 UTSW 2 112,957,201 (GRCm38) missense probably damaging 0.97
R9102:Ryr3 UTSW 2 112,678,561 (GRCm38) splice site probably benign
R9167:Ryr3 UTSW 2 112,834,053 (GRCm38) missense probably damaging 1.00
R9180:Ryr3 UTSW 2 112,661,636 (GRCm38) missense probably damaging 0.99
R9219:Ryr3 UTSW 2 112,912,239 (GRCm38) missense possibly damaging 0.62
R9258:Ryr3 UTSW 2 112,653,019 (GRCm38) missense probably damaging 0.99
R9300:Ryr3 UTSW 2 112,860,350 (GRCm38) missense probably benign
R9320:Ryr3 UTSW 2 112,779,991 (GRCm38) missense probably damaging 1.00
R9325:Ryr3 UTSW 2 112,649,295 (GRCm38) missense probably damaging 0.96
R9405:Ryr3 UTSW 2 112,834,267 (GRCm38) missense probably damaging 1.00
R9414:Ryr3 UTSW 2 112,670,666 (GRCm38) missense possibly damaging 0.81
R9489:Ryr3 UTSW 2 112,661,621 (GRCm38) missense probably damaging 1.00
R9522:Ryr3 UTSW 2 112,730,414 (GRCm38) missense probably benign 0.34
R9526:Ryr3 UTSW 2 112,833,925 (GRCm38) missense probably benign
R9529:Ryr3 UTSW 2 112,635,315 (GRCm38) missense possibly damaging 0.70
R9605:Ryr3 UTSW 2 112,661,621 (GRCm38) missense probably damaging 1.00
R9652:Ryr3 UTSW 2 112,804,702 (GRCm38) missense possibly damaging 0.66
R9660:Ryr3 UTSW 2 112,833,729 (GRCm38) missense probably benign
R9670:Ryr3 UTSW 2 112,730,500 (GRCm38) missense probably benign 0.28
R9673:Ryr3 UTSW 2 112,656,538 (GRCm38) missense possibly damaging 0.93
R9710:Ryr3 UTSW 2 112,803,189 (GRCm38) missense probably damaging 0.99
R9741:Ryr3 UTSW 2 112,646,926 (GRCm38) missense probably benign 0.00
R9772:Ryr3 UTSW 2 112,826,703 (GRCm38) missense probably damaging 0.96
RF010:Ryr3 UTSW 2 112,775,670 (GRCm38) missense probably damaging 0.97
RF040:Ryr3 UTSW 2 112,910,524 (GRCm38) critical splice acceptor site probably benign
RF044:Ryr3 UTSW 2 112,910,524 (GRCm38) critical splice acceptor site probably benign
X0057:Ryr3 UTSW 2 112,640,159 (GRCm38) missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112,912,302 (GRCm38) missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112,900,916 (GRCm38) missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112,728,924 (GRCm38) missense probably benign 0.01
Z1176:Ryr3 UTSW 2 112,712,374 (GRCm38) missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112,675,920 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCACTGTCATGGTGATCCC -3'
(R):5'- AAACTTTCAGTGTGTGCTTCTTCAC -3'

Sequencing Primer
(F):5'- TGGTGATCCCAGTTTCCTTAAAG -3'
(R):5'- GTGCTTCTTCACAAAAATGAGCC -3'
Posted On 2016-07-22