Mutagenetix > Incidental Mutation

Incidental Mutation 'R5206:Ints8'

402024

Institutional Source

Beutler Lab

Gene Symbol

Ints8

Ensembl Gene

ENSMUSG00000040738

Gene Name

integrator complex subunit 8

Synonyms

2810013E07Rik, D130008D20Rik

MMRRC Submission

042781-MU

Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11199158-11254258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11216477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 838 (I838N)

Ref Sequence

ENSEMBL: ENSMUSP00000103955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]

AlphaFold

Q80V86

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044616
AA Change: I838N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: I838N

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108318
AA Change: I838N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: I838N

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
SCOP:d1a17__	826	961	9e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108319
AA Change: I838N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: I838N

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133031

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137054

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145252

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,511	E487G	probably benign	Het
2610021A01Rik	A	T	7: 41,626,585	K571*	probably null	Het
4933415F23Rik	C	T	1: 23,102,102	G44R	probably benign	Het
A2m	T	C	6: 121,674,807	V1278A	probably damaging	Het
Abcc2	T	C	19: 43,818,150	V801A	probably damaging	Het
Acod1	T	A	14: 103,055,295	D418E	possibly damaging	Het
Bsn	G	A	9: 108,105,373	A3727V	unknown	Het
Cmah	T	G	13: 24,464,284	F501V	probably damaging	Het
Csf2rb2	T	A	15: 78,292,752	I173L	probably benign	Het
Dnah12	T	C	14: 26,769,985	W1126R	probably damaging	Het
Dock5	G	T	14: 67,763,184	A1690E	probably benign	Het
Dopey2	T	C	16: 93,801,584	L1879P	probably damaging	Het
Eif3j2	A	T	18: 43,477,582	D55E	probably benign	Het
Fam83f	G	A	15: 80,692,054	G302D	possibly damaging	Het
Fus	G	A	7: 127,969,797	G40D	unknown	Het
Glrp1	GTGCTGCTGCTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTGCTGCTGCTG	1: 88,503,275		probably benign	Het
Gxylt2	T	C	6: 100,804,615	V417A	probably damaging	Het
Hhipl1	G	A	12: 108,312,178	R255H	probably damaging	Het
Lama5	C	A	2: 180,191,304	C1579F	probably damaging	Het
Med13	C	T	11: 86,319,879	R479H	probably damaging	Het
Olfr1012	T	A	2: 85,759,623	Y251F	probably benign	Het
Olfr1467	G	T	19: 13,365,065	G146C	possibly damaging	Het
Olfr178	G	T	16: 58,890,018	N67K	probably damaging	Het
Olfr49	T	A	14: 54,282,698	M66L	probably benign	Het
Olfr610	A	T	7: 103,506,102	Y281*	probably null	Het
Pak6	A	G	2: 118,693,303	E313G	probably benign	Het
Pigs	T	A	11: 78,333,723	Y145N	probably damaging	Het
Pla2g2f	T	A	4: 138,752,351	D165V	probably benign	Het
Plbd1	C	T	6: 136,641,156	V133M	probably benign	Het
Ryr3	T	C	2: 112,844,711	Y1352C	probably damaging	Het
Scamp1	C	T	13: 94,232,107	R51H	probably damaging	Het
Slc2a2	G	A	3: 28,708,607	V100M	probably damaging	Het
Slc38a10	C	G	11: 120,105,062	A1062P	probably damaging	Het
Snai1	T	C	2: 167,538,968	I127T	probably benign	Het
Stat4	G	A	1: 52,105,236	G692D	probably damaging	Het
Stc1	A	T	14: 69,031,599	D72V	probably damaging	Het
Tmc1	T	C	19: 20,826,660	N351S	probably damaging	Het
Trim28	A	G	7: 13,025,348	I130V	probably benign	Het
Trim39	A	G	17: 36,260,490	Y459H	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ugt1a6b	C	A	1: 88,107,448	Y169*	probably null	Het
Vasp	T	C	7: 19,258,855		probably benign	Het
Vmn2r99	G	T	17: 19,378,606	G184V	probably benign	Het
Xrcc1	C	T	7: 24,567,563	T358I	probably damaging	Het
Zfp219	A	G	14: 52,009,565	V35A	probably benign	Het

Other mutations in Ints8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Ints8	APN	4	11218679	splice site	probably benign
IGL01925:Ints8	APN	4	11235617	splice site	probably benign
IGL02195:Ints8	APN	4	11221222	missense	probably damaging	1.00
IGL02215:Ints8	APN	4	11209244	missense	probably damaging	1.00
IGL02429:Ints8	APN	4	11231720	missense	probably damaging	1.00
IGL02484:Ints8	APN	4	11208834	nonsense	probably null
IGL02558:Ints8	APN	4	11218771	missense	probably damaging	1.00
IGL02725:Ints8	APN	4	11239406	missense	probably benign	0.01
IGL02742:Ints8	APN	4	11241627	missense	possibly damaging	0.75
IGL02831:Ints8	APN	4	11245896	missense	possibly damaging	0.51
IGL03140:Ints8	APN	4	11235565	missense	probably damaging	1.00
IGL03171:Ints8	APN	4	11231702	missense	probably benign	0.01
IGL03335:Ints8	APN	4	11216460	missense	probably damaging	1.00
G1Funyon:Ints8	UTSW	4	11246120	missense	probably damaging	1.00
P0026:Ints8	UTSW	4	11225788	nonsense	probably null
R0054:Ints8	UTSW	4	11204595	utr 3 prime	probably benign
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0184:Ints8	UTSW	4	11218637	missense	probably benign	0.03
R0299:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0499:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0540:Ints8	UTSW	4	11252926	missense	possibly damaging	0.94
R0657:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R1232:Ints8	UTSW	4	11234587	missense	possibly damaging	0.81
R1296:Ints8	UTSW	4	11221204	missense	possibly damaging	0.95
R1390:Ints8	UTSW	4	11239461	missense	probably benign	0.22
R1503:Ints8	UTSW	4	11245842	missense	probably damaging	0.97
R1587:Ints8	UTSW	4	11245722	critical splice donor site	probably null
R1701:Ints8	UTSW	4	11231656	missense	probably damaging	1.00
R1721:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1757:Ints8	UTSW	4	11254109	start codon destroyed	probably null	0.99
R1777:Ints8	UTSW	4	11225600	critical splice donor site	probably null
R1867:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1868:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1952:Ints8	UTSW	4	11221150	missense	probably benign	0.21
R2084:Ints8	UTSW	4	11230377	missense	probably benign	0.31
R2108:Ints8	UTSW	4	11235552	missense	probably damaging	0.99
R2202:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2203:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2205:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2439:Ints8	UTSW	4	11225725	missense	probably benign	0.29
R2504:Ints8	UTSW	4	11241642	missense	probably benign	0.03
R3824:Ints8	UTSW	4	11225621	nonsense	probably null
R4664:Ints8	UTSW	4	11227152	missense	probably benign	0.04
R4703:Ints8	UTSW	4	11223785	missense	possibly damaging	0.92
R4895:Ints8	UTSW	4	11230367	nonsense	probably null
R5262:Ints8	UTSW	4	11211916	missense	probably damaging	1.00
R5505:Ints8	UTSW	4	11221143	missense	probably benign	0.18
R5513:Ints8	UTSW	4	11248303	missense	possibly damaging	0.79
R5750:Ints8	UTSW	4	11241654	missense	possibly damaging	0.81
R5892:Ints8	UTSW	4	11223813	missense	probably damaging	1.00
R6007:Ints8	UTSW	4	11208845	missense	possibly damaging	0.70
R6229:Ints8	UTSW	4	11252891	missense	probably damaging	1.00
R6466:Ints8	UTSW	4	11252878	missense	probably damaging	0.99
R6709:Ints8	UTSW	4	11221117	missense	possibly damaging	0.65
R6986:Ints8	UTSW	4	11204474	missense	probably damaging	1.00
R6998:Ints8	UTSW	4	11204537	missense	possibly damaging	0.80
R7074:Ints8	UTSW	4	11204574	missense	possibly damaging	0.82
R7221:Ints8	UTSW	4	11225613	missense	probably benign	0.01
R7772:Ints8	UTSW	4	11227190	missense	probably damaging	0.97
R7872:Ints8	UTSW	4	11254062	missense	probably benign	0.00
R7953:Ints8	UTSW	4	11227128	missense	probably benign
R8184:Ints8	UTSW	4	11204534	missense	probably damaging	1.00
R8301:Ints8	UTSW	4	11246120	missense	probably damaging	1.00
R8708:Ints8	UTSW	4	11208824	critical splice donor site	probably null
R8868:Ints8	UTSW	4	11230488	missense	probably benign
R9245:Ints8	UTSW	4	11213811	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCACTATTTAAAGGGAGGGGACAC -3'
(R):5'- ATTGAGACCCTGGTTGTGTC -3'

Sequencing Primer
(F):5'- CATGTCAGAGGGCTCACATTGAC -3'
(R):5'- AGACCCTGGTTGTGTCTTTTG -3'

Posted On

2016-07-22