Incidental Mutation 'R5206:Ints8'
ID402024
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission 042781-MU
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11216477 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 838 (I838N)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044616
AA Change: I838N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: I838N

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108318
AA Change: I838N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: I838N

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108319
AA Change: I838N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: I838N

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145252
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11246120 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
R7772:Ints8 UTSW 4 11227190 missense probably damaging 0.97
R7872:Ints8 UTSW 4 11254062 missense probably benign 0.00
R7953:Ints8 UTSW 4 11227128 missense probably benign
R8184:Ints8 UTSW 4 11204534 missense probably damaging 1.00
R8301:Ints8 UTSW 4 11246120 missense probably damaging 1.00
R8708:Ints8 UTSW 4 11208824 critical splice donor site probably null
R8868:Ints8 UTSW 4 11230488 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCACTATTTAAAGGGAGGGGACAC -3'
(R):5'- ATTGAGACCCTGGTTGTGTC -3'

Sequencing Primer
(F):5'- CATGTCAGAGGGCTCACATTGAC -3'
(R):5'- AGACCCTGGTTGTGTCTTTTG -3'
Posted On2016-07-22