Mutagenetix > Incidental Mutation

Incidental Mutation 'R5206:Gxylt2'

402026

Institutional Source

Beutler Lab

Gene Symbol

Gxylt2

Ensembl Gene

ENSMUSG00000030074

Gene Name

glucoside xylosyltransferase 2

Synonyms

LOC232313, Glt8d4

MMRRC Submission

042781-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100704734-100810913 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100804615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 417 (V417A)

Ref Sequence

ENSEMBL: ENSMUSP00000032157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032157]

AlphaFold

Q810K9

Predicted Effect

probably damaging
Transcript: ENSMUST00000032157
AA Change: V417A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032157
Gene: ENSMUSG00000030074
AA Change: V417A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	55	89	N/A	INTRINSIC
Pfam:Glyco_transf_8	112	364	1.5e-15	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a xylosyltransferase that elongates O-linked glucose bound to epidermal growth factor (EGF) repeats. The encoded protein catalyzes the addition of xylose to the O-glucose-modified residues of EGF repeats of Notch proteins. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,511	E487G	probably benign	Het
2610021A01Rik	A	T	7: 41,626,585	K571*	probably null	Het
4933415F23Rik	C	T	1: 23,102,102	G44R	probably benign	Het
A2m	T	C	6: 121,674,807	V1278A	probably damaging	Het
Abcc2	T	C	19: 43,818,150	V801A	probably damaging	Het
Acod1	T	A	14: 103,055,295	D418E	possibly damaging	Het
Bsn	G	A	9: 108,105,373	A3727V	unknown	Het
Cmah	T	G	13: 24,464,284	F501V	probably damaging	Het
Csf2rb2	T	A	15: 78,292,752	I173L	probably benign	Het
Dnah12	T	C	14: 26,769,985	W1126R	probably damaging	Het
Dock5	G	T	14: 67,763,184	A1690E	probably benign	Het
Dopey2	T	C	16: 93,801,584	L1879P	probably damaging	Het
Eif3j2	A	T	18: 43,477,582	D55E	probably benign	Het
Fam83f	G	A	15: 80,692,054	G302D	possibly damaging	Het
Fus	G	A	7: 127,969,797	G40D	unknown	Het
Glrp1	GTGCTGCTGCTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTGCTGCTGCTG	1: 88,503,275		probably benign	Het
Hhipl1	G	A	12: 108,312,178	R255H	probably damaging	Het
Ints8	A	T	4: 11,216,477	I838N	possibly damaging	Het
Lama5	C	A	2: 180,191,304	C1579F	probably damaging	Het
Med13	C	T	11: 86,319,879	R479H	probably damaging	Het
Olfr1012	T	A	2: 85,759,623	Y251F	probably benign	Het
Olfr1467	G	T	19: 13,365,065	G146C	possibly damaging	Het
Olfr178	G	T	16: 58,890,018	N67K	probably damaging	Het
Olfr49	T	A	14: 54,282,698	M66L	probably benign	Het
Olfr610	A	T	7: 103,506,102	Y281*	probably null	Het
Pak6	A	G	2: 118,693,303	E313G	probably benign	Het
Pigs	T	A	11: 78,333,723	Y145N	probably damaging	Het
Pla2g2f	T	A	4: 138,752,351	D165V	probably benign	Het
Plbd1	C	T	6: 136,641,156	V133M	probably benign	Het
Ryr3	T	C	2: 112,844,711	Y1352C	probably damaging	Het
Scamp1	C	T	13: 94,232,107	R51H	probably damaging	Het
Slc2a2	G	A	3: 28,708,607	V100M	probably damaging	Het
Slc38a10	C	G	11: 120,105,062	A1062P	probably damaging	Het
Snai1	T	C	2: 167,538,968	I127T	probably benign	Het
Stat4	G	A	1: 52,105,236	G692D	probably damaging	Het
Stc1	A	T	14: 69,031,599	D72V	probably damaging	Het
Tmc1	T	C	19: 20,826,660	N351S	probably damaging	Het
Trim28	A	G	7: 13,025,348	I130V	probably benign	Het
Trim39	A	G	17: 36,260,490	Y459H	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ugt1a6b	C	A	1: 88,107,448	Y169*	probably null	Het
Vasp	T	C	7: 19,258,855		probably benign	Het
Vmn2r99	G	T	17: 19,378,606	G184V	probably benign	Het
Xrcc1	C	T	7: 24,567,563	T358I	probably damaging	Het
Zfp219	A	G	14: 52,009,565	V35A	probably benign	Het

Other mutations in Gxylt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Gxylt2	APN	6	100750447	missense	probably damaging	1.00
IGL01533:Gxylt2	APN	6	100783137	missense	probably damaging	1.00
R0047:Gxylt2	UTSW	6	100733378	splice site	probably benign
R0047:Gxylt2	UTSW	6	100733378	splice site	probably benign
R0328:Gxylt2	UTSW	6	100750535	splice site	probably benign
R1159:Gxylt2	UTSW	6	100804641	missense	possibly damaging	0.82
R2173:Gxylt2	UTSW	6	100798154	missense	probably damaging	1.00
R2307:Gxylt2	UTSW	6	100787212	missense	probably damaging	1.00
R4112:Gxylt2	UTSW	6	100783206	missense	probably damaging	1.00
R4378:Gxylt2	UTSW	6	100733200	missense	probably benign	0.00
R5032:Gxylt2	UTSW	6	100783181	missense	probably benign	0.22
R5305:Gxylt2	UTSW	6	100787218	missense	probably damaging	0.98
R5394:Gxylt2	UTSW	6	100705114	missense	probably benign	0.01
R5497:Gxylt2	UTSW	6	100787329	missense	probably benign	0.10
R5814:Gxylt2	UTSW	6	100733235	missense	probably damaging	1.00
R5864:Gxylt2	UTSW	6	100783146	missense	probably damaging	1.00
R6038:Gxylt2	UTSW	6	100804594	missense	probably damaging	1.00
R6038:Gxylt2	UTSW	6	100804594	missense	probably damaging	1.00
R6314:Gxylt2	UTSW	6	100798203	missense	probably damaging	1.00
R7051:Gxylt2	UTSW	6	100804576	nonsense	probably null
R7375:Gxylt2	UTSW	6	100750422	missense	probably benign	0.28
R7607:Gxylt2	UTSW	6	100798190	missense	possibly damaging	0.95
R7617:Gxylt2	UTSW	6	100783185	missense	probably damaging	1.00
R7658:Gxylt2	UTSW	6	100783143	missense	probably damaging	1.00
R7685:Gxylt2	UTSW	6	100804528	missense	probably benign	0.01
R7744:Gxylt2	UTSW	6	100783317	missense	probably damaging	0.99
R7980:Gxylt2	UTSW	6	100787209	critical splice acceptor site	probably null
R8093:Gxylt2	UTSW	6	100733227	missense	probably damaging	1.00
R8743:Gxylt2	UTSW	6	100787323	missense	probably benign	0.01
R8777:Gxylt2	UTSW	6	100750471	missense	probably damaging	0.99
R8777-TAIL:Gxylt2	UTSW	6	100750471	missense	probably damaging	0.99
R8871:Gxylt2	UTSW	6	100783148	missense	probably damaging	0.99
R9130:Gxylt2	UTSW	6	100733368	nonsense	probably null
R9524:Gxylt2	UTSW	6	100750455	missense	probably benign	0.22
Z1176:Gxylt2	UTSW	6	100783191	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCACTGGGCCAAAGCTTAG -3'
(R):5'- TTGAACCGCAACAGTCACAGAG -3'

Sequencing Primer
(F):5'- TTAATCCCAGCATTCGGGAG -3'
(R):5'- AGTCACAGAGCACCATTAAATATTC -3'

Posted On

2016-07-22