Incidental Mutation 'R5206:Gxylt2'
ID402026
Institutional Source Beutler Lab
Gene Symbol Gxylt2
Ensembl Gene ENSMUSG00000030074
Gene Nameglucoside xylosyltransferase 2
SynonymsLOC232313, Glt8d4
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location100704734-100810913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100804615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 417 (V417A)
Ref Sequence ENSEMBL: ENSMUSP00000032157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032157]
Predicted Effect probably damaging
Transcript: ENSMUST00000032157
AA Change: V417A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032157
Gene: ENSMUSG00000030074
AA Change: V417A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 55 89 N/A INTRINSIC
Pfam:Glyco_transf_8 112 364 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a xylosyltransferase that elongates O-linked glucose bound to epidermal growth factor (EGF) repeats. The encoded protein catalyzes the addition of xylose to the O-glucose-modified residues of EGF repeats of Notch proteins. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Gxylt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Gxylt2 APN 6 100750447 missense probably damaging 1.00
IGL01533:Gxylt2 APN 6 100783137 missense probably damaging 1.00
R0047:Gxylt2 UTSW 6 100733378 splice site probably benign
R0047:Gxylt2 UTSW 6 100733378 splice site probably benign
R0328:Gxylt2 UTSW 6 100750535 splice site probably benign
R1159:Gxylt2 UTSW 6 100804641 missense possibly damaging 0.82
R2173:Gxylt2 UTSW 6 100798154 missense probably damaging 1.00
R2307:Gxylt2 UTSW 6 100787212 missense probably damaging 1.00
R4112:Gxylt2 UTSW 6 100783206 missense probably damaging 1.00
R4378:Gxylt2 UTSW 6 100733200 missense probably benign 0.00
R5032:Gxylt2 UTSW 6 100783181 missense probably benign 0.22
R5305:Gxylt2 UTSW 6 100787218 missense probably damaging 0.98
R5394:Gxylt2 UTSW 6 100705114 missense probably benign 0.01
R5497:Gxylt2 UTSW 6 100787329 missense probably benign 0.10
R5814:Gxylt2 UTSW 6 100733235 missense probably damaging 1.00
R5864:Gxylt2 UTSW 6 100783146 missense probably damaging 1.00
R6038:Gxylt2 UTSW 6 100804594 missense probably damaging 1.00
R6038:Gxylt2 UTSW 6 100804594 missense probably damaging 1.00
R6314:Gxylt2 UTSW 6 100798203 missense probably damaging 1.00
R7051:Gxylt2 UTSW 6 100804576 nonsense probably null
R7375:Gxylt2 UTSW 6 100750422 missense probably benign 0.28
R7607:Gxylt2 UTSW 6 100798190 missense possibly damaging 0.95
R7617:Gxylt2 UTSW 6 100783185 missense probably damaging 1.00
R7658:Gxylt2 UTSW 6 100783143 missense probably damaging 1.00
R7685:Gxylt2 UTSW 6 100804528 missense probably benign 0.01
R7744:Gxylt2 UTSW 6 100783317 missense probably damaging 0.99
R7980:Gxylt2 UTSW 6 100787209 critical splice acceptor site probably null
R8093:Gxylt2 UTSW 6 100733227 missense probably damaging 1.00
Z1176:Gxylt2 UTSW 6 100783191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTGGGCCAAAGCTTAG -3'
(R):5'- TTGAACCGCAACAGTCACAGAG -3'

Sequencing Primer
(F):5'- TTAATCCCAGCATTCGGGAG -3'
(R):5'- AGTCACAGAGCACCATTAAATATTC -3'
Posted On2016-07-22