Incidental Mutation 'R5206:Pigs'
ID402036
Institutional Source Beutler Lab
Gene Symbol Pigs
Ensembl Gene ENSMUSG00000041958
Gene Namephosphatidylinositol glycan anchor biosynthesis, class S
SynonymsLOC245087, LOC276846
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78328415-78342782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78333723 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 145 (Y145N)
Ref Sequence ENSEMBL: ENSMUSP00000044871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048073]
Predicted Effect probably damaging
Transcript: ENSMUST00000048073
AA Change: Y145N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044871
Gene: ENSMUSG00000041958
AA Change: Y145N

DomainStartEndE-ValueType
Pfam:PIG-S 22 547 3.3e-144 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Pigs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Pigs APN 11 78340031 missense probably benign
feral UTSW 11 78336739 missense possibly damaging 0.94
R0094:Pigs UTSW 11 78340038 missense probably damaging 0.98
R0490:Pigs UTSW 11 78335625 missense probably damaging 1.00
R1027:Pigs UTSW 11 78336825 missense probably damaging 1.00
R1073:Pigs UTSW 11 78335605 missense probably benign 0.09
R1157:Pigs UTSW 11 78328994 missense possibly damaging 0.87
R1754:Pigs UTSW 11 78337847 missense probably damaging 0.99
R1881:Pigs UTSW 11 78341756 missense probably benign 0.00
R2171:Pigs UTSW 11 78328812 missense probably damaging 1.00
R2386:Pigs UTSW 11 78332986 missense probably damaging 1.00
R4928:Pigs UTSW 11 78329002 missense probably damaging 0.99
R5480:Pigs UTSW 11 78329075 missense possibly damaging 0.58
R5665:Pigs UTSW 11 78328769 synonymous probably null
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6159:Pigs UTSW 11 78328500 missense probably benign 0.01
R6572:Pigs UTSW 11 78339364 missense probably damaging 0.98
R6618:Pigs UTSW 11 78341230 missense probably damaging 1.00
R7052:Pigs UTSW 11 78341385 missense probably damaging 1.00
R7065:Pigs UTSW 11 78336739 missense possibly damaging 0.94
R7352:Pigs UTSW 11 78328812 missense probably damaging 1.00
R7851:Pigs UTSW 11 78336787 missense probably damaging 1.00
R7934:Pigs UTSW 11 78336787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAAGGGAGATGCCATGG -3'
(R):5'- ACCAAGAGACGGCATGAAGC -3'

Sequencing Primer
(F):5'- CCATGGGCTTCTGCTGAG -3'
(R):5'- TACAGTCTCTGAAAAAGGCCCTGG -3'
Posted On2016-07-22