Incidental Mutation 'R5206:Med13'
ID 402037
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 042781-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R5206 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86210705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 479 (R479H)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: R479H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: R479H

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,772,272 (GRCm39) E487G probably benign Het
2610021A01Rik A T 7: 41,276,009 (GRCm39) K571* probably null Het
A2m T C 6: 121,651,766 (GRCm39) V1278A probably damaging Het
Abcc2 T C 19: 43,806,589 (GRCm39) V801A probably damaging Het
Acod1 T A 14: 103,292,731 (GRCm39) D418E possibly damaging Het
Bsn G A 9: 107,982,572 (GRCm39) A3727V unknown Het
Cmah T G 13: 24,648,267 (GRCm39) F501V probably damaging Het
Csf2rb2 T A 15: 78,176,952 (GRCm39) I173L probably benign Het
Dnah12 T C 14: 26,491,942 (GRCm39) W1126R probably damaging Het
Dock5 G T 14: 68,000,633 (GRCm39) A1690E probably benign Het
Dop1b T C 16: 93,598,472 (GRCm39) L1879P probably damaging Het
Eif3j2 A T 18: 43,610,647 (GRCm39) D55E probably benign Het
Fam83f G A 15: 80,576,255 (GRCm39) G302D possibly damaging Het
Fus G A 7: 127,568,969 (GRCm39) G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,430,997 (GRCm39) probably benign Het
Gxylt2 T C 6: 100,781,576 (GRCm39) V417A probably damaging Het
Hhipl1 G A 12: 108,278,437 (GRCm39) R255H probably damaging Het
Ints8 A T 4: 11,216,477 (GRCm39) I838N possibly damaging Het
Lama5 C A 2: 179,833,097 (GRCm39) C1579F probably damaging Het
Or51ag1 A T 7: 103,155,309 (GRCm39) Y281* probably null Het
Or5b113 G T 19: 13,342,429 (GRCm39) G146C possibly damaging Het
Or5k15 G T 16: 58,710,381 (GRCm39) N67K probably damaging Het
Or6e1 T A 14: 54,520,155 (GRCm39) M66L probably benign Het
Or9g3 T A 2: 85,589,967 (GRCm39) Y251F probably benign Het
Pak6 A G 2: 118,523,784 (GRCm39) E313G probably benign Het
Pigs T A 11: 78,224,549 (GRCm39) Y145N probably damaging Het
Pla2g2f T A 4: 138,479,662 (GRCm39) D165V probably benign Het
Plbd1 C T 6: 136,618,154 (GRCm39) V133M probably benign Het
Ppp1r14bl C T 1: 23,141,183 (GRCm39) G44R probably benign Het
Ryr3 T C 2: 112,675,056 (GRCm39) Y1352C probably damaging Het
Scamp1 C T 13: 94,368,615 (GRCm39) R51H probably damaging Het
Skic3 G A 13: 76,295,886 (GRCm39) E1050K possibly damaging Het
Slc2a2 G A 3: 28,762,756 (GRCm39) V100M probably damaging Het
Slc38a10 C G 11: 119,995,888 (GRCm39) A1062P probably damaging Het
Snai1 T C 2: 167,380,888 (GRCm39) I127T probably benign Het
Stat4 G A 1: 52,144,395 (GRCm39) G692D probably damaging Het
Stc1 A T 14: 69,269,048 (GRCm39) D72V probably damaging Het
Tmc1 T C 19: 20,804,024 (GRCm39) N351S probably damaging Het
Trim28 A G 7: 12,759,275 (GRCm39) I130V probably benign Het
Trim39 A G 17: 36,571,382 (GRCm39) Y459H probably damaging Het
Ugt1a6b C A 1: 88,035,170 (GRCm39) Y169* probably null Het
Vasp T C 7: 18,992,780 (GRCm39) probably benign Het
Vmn2r99 G T 17: 19,598,868 (GRCm39) G184V probably benign Het
Xrcc1 C T 7: 24,266,988 (GRCm39) T358I probably damaging Het
Zfp219 A G 14: 52,247,022 (GRCm39) V35A probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGGTGTTTTAGTCACTCCTTCATC -3'
(R):5'- CCAATGACCTTACTGTCTCAAAATC -3'

Sequencing Primer
(F):5'- TAGTCACTCCTTCATCAACCACATC -3'
(R):5'- GACAGGCACCATCTTTAG -3'
Posted On 2016-07-22