Incidental Mutation 'R5206:Med13'
ID402037
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86319879 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 479 (R479H)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: R479H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: R479H

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0197_Med13_854 UTSW 11 86307038 missense probably benign 0.13
R0360_Med13_060 UTSW 11 86329161 splice site probably benign
R2359_Med13_079 UTSW 11 86291035 splice site probably benign
R3735_Med13_085 UTSW 11 86279658 missense probably benign 0.00
R4974_Med13_508 UTSW 11 86298847 missense probably damaging 0.98
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R7922:Med13 UTSW 11 86271005 missense probably damaging 0.98
R7943:Med13 UTSW 11 86278526 missense probably damaging 0.97
R8062:Med13 UTSW 11 86319438 missense probably benign
R8075:Med13 UTSW 11 86272470 missense probably damaging 0.98
R8207:Med13 UTSW 11 86303549 missense probably damaging 1.00
R8671:Med13 UTSW 11 86271097 missense probably damaging 1.00
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGTTTTAGTCACTCCTTCATC -3'
(R):5'- CCAATGACCTTACTGTCTCAAAATC -3'

Sequencing Primer
(F):5'- TAGTCACTCCTTCATCAACCACATC -3'
(R):5'- GACAGGCACCATCTTTAG -3'
Posted On2016-07-22