Mutagenetix > Incidental Mutation

Incidental Mutation 'R5206:Dock5'

402046

Institutional Source

Beutler Lab

Gene Symbol

Dock5

Ensembl Gene

ENSMUSG00000044447

Gene Name

dedicator of cytokinesis 5

Synonyms

lr2, 1110060D06Rik, rlc

MMRRC Submission

042781-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R5206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67752135-67933442 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67763184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 1690 (A1690E)

Ref Sequence

ENSEMBL: ENSMUSP00000036674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039135]

AlphaFold

B2RY04

Predicted Effect

probably benign
Transcript: ENSMUST00000039135
AA Change: A1690E

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: A1690E

Domain	Start	End	E-Value	Type
SH3	11	68	1.45e-13	SMART
Pfam:DOCK_N	71	434	9e-110	PFAM
Pfam:DOCK-C2	439	636	1.1e-57	PFAM
low complexity region	752	764	N/A	INTRINSIC
Pfam:DHR-2	1133	1635	6.4e-99	PFAM
low complexity region	1663	1692	N/A	INTRINSIC
low complexity region	1815	1824	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226033

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,511	E487G	probably benign	Het
2610021A01Rik	A	T	7: 41,626,585	K571*	probably null	Het
4933415F23Rik	C	T	1: 23,102,102	G44R	probably benign	Het
A2m	T	C	6: 121,674,807	V1278A	probably damaging	Het
Abcc2	T	C	19: 43,818,150	V801A	probably damaging	Het
Acod1	T	A	14: 103,055,295	D418E	possibly damaging	Het
Bsn	G	A	9: 108,105,373	A3727V	unknown	Het
Cmah	T	G	13: 24,464,284	F501V	probably damaging	Het
Csf2rb2	T	A	15: 78,292,752	I173L	probably benign	Het
Dnah12	T	C	14: 26,769,985	W1126R	probably damaging	Het
Dopey2	T	C	16: 93,801,584	L1879P	probably damaging	Het
Eif3j2	A	T	18: 43,477,582	D55E	probably benign	Het
Fam83f	G	A	15: 80,692,054	G302D	possibly damaging	Het
Fus	G	A	7: 127,969,797	G40D	unknown	Het
Glrp1	GTGCTGCTGCTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTGCTGCTGCTG	1: 88,503,275		probably benign	Het
Gxylt2	T	C	6: 100,804,615	V417A	probably damaging	Het
Hhipl1	G	A	12: 108,312,178	R255H	probably damaging	Het
Ints8	A	T	4: 11,216,477	I838N	possibly damaging	Het
Lama5	C	A	2: 180,191,304	C1579F	probably damaging	Het
Med13	C	T	11: 86,319,879	R479H	probably damaging	Het
Olfr1012	T	A	2: 85,759,623	Y251F	probably benign	Het
Olfr1467	G	T	19: 13,365,065	G146C	possibly damaging	Het
Olfr178	G	T	16: 58,890,018	N67K	probably damaging	Het
Olfr49	T	A	14: 54,282,698	M66L	probably benign	Het
Olfr610	A	T	7: 103,506,102	Y281*	probably null	Het
Pak6	A	G	2: 118,693,303	E313G	probably benign	Het
Pigs	T	A	11: 78,333,723	Y145N	probably damaging	Het
Pla2g2f	T	A	4: 138,752,351	D165V	probably benign	Het
Plbd1	C	T	6: 136,641,156	V133M	probably benign	Het
Ryr3	T	C	2: 112,844,711	Y1352C	probably damaging	Het
Scamp1	C	T	13: 94,232,107	R51H	probably damaging	Het
Slc2a2	G	A	3: 28,708,607	V100M	probably damaging	Het
Slc38a10	C	G	11: 120,105,062	A1062P	probably damaging	Het
Snai1	T	C	2: 167,538,968	I127T	probably benign	Het
Stat4	G	A	1: 52,105,236	G692D	probably damaging	Het
Stc1	A	T	14: 69,031,599	D72V	probably damaging	Het
Tmc1	T	C	19: 20,826,660	N351S	probably damaging	Het
Trim28	A	G	7: 13,025,348	I130V	probably benign	Het
Trim39	A	G	17: 36,260,490	Y459H	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ugt1a6b	C	A	1: 88,107,448	Y169*	probably null	Het
Vasp	T	C	7: 19,258,855		probably benign	Het
Vmn2r99	G	T	17: 19,378,606	G184V	probably benign	Het
Xrcc1	C	T	7: 24,567,563	T358I	probably damaging	Het
Zfp219	A	G	14: 52,009,565	V35A	probably benign	Het

Other mutations in Dock5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Dock5	APN	14	67786889	splice site	probably benign
IGL00930:Dock5	APN	14	67771077	missense	probably damaging	1.00
IGL01525:Dock5	APN	14	67805720	splice site	probably benign
IGL01759:Dock5	APN	14	67881259	nonsense	probably null
IGL01941:Dock5	APN	14	67812232	missense	probably damaging	1.00
IGL02025:Dock5	APN	14	67763287	missense	probably damaging	1.00
IGL02093:Dock5	APN	14	67839543	splice site	probably benign
IGL02179:Dock5	APN	14	67806496	splice site	probably benign
IGL02208:Dock5	APN	14	67828450	missense	probably benign	0.06
IGL02605:Dock5	APN	14	67828438	missense	probably benign	0.18
IGL02608:Dock5	APN	14	67828439	missense	probably benign	0.01
IGL02938:Dock5	APN	14	67757218	splice site	probably benign
IGL02971:Dock5	APN	14	67757109	missense	probably null	1.00
IGL02983:Dock5	APN	14	67764670	missense	probably damaging	1.00
IGL03151:Dock5	APN	14	67866067	missense	probably damaging	1.00
IGL03410:Dock5	APN	14	67846086	missense	probably benign	0.04
PIT4366001:Dock5	UTSW	14	67824674	missense	possibly damaging	0.83
R0026:Dock5	UTSW	14	67846081	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0112:Dock5	UTSW	14	67819641	missense	probably benign
R0127:Dock5	UTSW	14	67846042	missense	probably benign	0.13
R0144:Dock5	UTSW	14	67786286	missense	probably benign	0.18
R0312:Dock5	UTSW	14	67795991	missense	possibly damaging	0.82
R0360:Dock5	UTSW	14	67822680	splice site	probably benign
R0364:Dock5	UTSW	14	67822680	splice site	probably benign
R0496:Dock5	UTSW	14	67817518	missense	probably damaging	1.00
R0506:Dock5	UTSW	14	67784792	splice site	probably benign
R0586:Dock5	UTSW	14	67809032	missense	probably damaging	1.00
R0597:Dock5	UTSW	14	67784934	splice site	probably null
R0625:Dock5	UTSW	14	67841163	missense	probably benign
R1109:Dock5	UTSW	14	67806478	missense	possibly damaging	0.80
R1221:Dock5	UTSW	14	67759161	missense	probably benign	0.00
R1278:Dock5	UTSW	14	67839566	missense	possibly damaging	0.80
R1927:Dock5	UTSW	14	67846062	missense	possibly damaging	0.60
R1944:Dock5	UTSW	14	67757135	nonsense	probably null
R1946:Dock5	UTSW	14	67786316	missense	probably damaging	1.00
R2046:Dock5	UTSW	14	67812142	missense	probably benign
R2101:Dock5	UTSW	14	67794010	missense	probably benign	0.02
R2252:Dock5	UTSW	14	67784812	missense	probably damaging	0.98
R2882:Dock5	UTSW	14	67839620	missense	probably damaging	0.99
R3110:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R3112:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R4236:Dock5	UTSW	14	67756492	missense	probably benign	0.02
R4242:Dock5	UTSW	14	67828490	missense	probably benign	0.19
R4244:Dock5	UTSW	14	67774582	missense	probably benign	0.41
R4646:Dock5	UTSW	14	67842779	missense	probably benign	0.01
R4793:Dock5	UTSW	14	67800354	missense	probably benign	0.26
R4841:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R4842:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R5159:Dock5	UTSW	14	67792289	missense	probably benign	0.04
R5164:Dock5	UTSW	14	67817661	nonsense	probably null
R5207:Dock5	UTSW	14	67776284	missense	probably benign	0.06
R5322:Dock5	UTSW	14	67770266	missense	probably benign	0.41
R5374:Dock5	UTSW	14	67805756	missense	possibly damaging	0.81
R5413:Dock5	UTSW	14	67764655	missense	probably damaging	1.00
R5476:Dock5	UTSW	14	67814007	missense	possibly damaging	0.92
R5504:Dock5	UTSW	14	67803086	missense	probably benign	0.01
R5677:Dock5	UTSW	14	67777603	missense	probably benign	0.00
R5773:Dock5	UTSW	14	67796058	missense	possibly damaging	0.95
R5845:Dock5	UTSW	14	67841101	missense	possibly damaging	0.82
R5957:Dock5	UTSW	14	67857994	missense	probably benign
R6154:Dock5	UTSW	14	67859912	missense	probably benign	0.03
R6268:Dock5	UTSW	14	67790275	nonsense	probably null
R6393:Dock5	UTSW	14	67822602	missense	probably benign	0.32
R6512:Dock5	UTSW	14	67824648	missense	possibly damaging	0.93
R6759:Dock5	UTSW	14	67795996	missense	probably benign	0.00
R7012:Dock5	UTSW	14	67822586	missense	probably damaging	1.00
R7061:Dock5	UTSW	14	67770254	missense	probably damaging	0.96
R7196:Dock5	UTSW	14	67756470	missense	probably damaging	1.00
R7200:Dock5	UTSW	14	67771702	nonsense	probably null
R7311:Dock5	UTSW	14	67828502	missense	probably benign	0.25
R7359:Dock5	UTSW	14	67765888	missense	probably benign	0.10
R7422:Dock5	UTSW	14	67809030	missense	probably benign	0.01
R7588:Dock5	UTSW	14	67763158	critical splice donor site	probably null
R7637:Dock5	UTSW	14	67786340	missense	possibly damaging	0.95
R7709:Dock5	UTSW	14	67796005	missense	probably benign	0.44
R7763:Dock5	UTSW	14	67821327	missense	probably damaging	0.97
R8044:Dock5	UTSW	14	67824692	missense	probably damaging	1.00
R8076:Dock5	UTSW	14	67802977	splice site	probably null
R8168:Dock5	UTSW	14	67770197	splice site	probably null
R8353:Dock5	UTSW	14	67817508	splice site	probably null
R8480:Dock5	UTSW	14	67836410	missense	probably benign	0.32
R8535:Dock5	UTSW	14	67793976	missense	probably benign	0.19
R8708:Dock5	UTSW	14	67767371	missense	probably benign	0.02
R8732:Dock5	UTSW	14	67846000	missense	possibly damaging	0.85
R8888:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8895:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8936:Dock5	UTSW	14	67845990	nonsense	probably null
R8962:Dock5	UTSW	14	67757191	missense	probably benign
R8972:Dock5	UTSW	14	67776300	missense	probably damaging	1.00
R9244:Dock5	UTSW	14	67759114	missense	probably damaging	0.99
R9345:Dock5	UTSW	14	67822622	missense	possibly damaging	0.74
R9679:Dock5	UTSW	14	67781001	missense	probably damaging	1.00
X0023:Dock5	UTSW	14	67771088	missense	probably benign	0.15
Z1177:Dock5	UTSW	14	67813933	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GTGGTGGTCCTCATGAAGAG -3'
(R):5'- GATTTCATGAGACCGACAGGG -3'

Sequencing Primer
(F):5'- TCATGAAGAGATGTGGAGGAGCC -3'
(R):5'- ATTGCAGGCTGCTAACCTGAG -3'

Posted On

2016-07-22