Incidental Mutation 'R5206:Stc1'
ID402047
Institutional Source Beutler Lab
Gene Symbol Stc1
Ensembl Gene ENSMUSG00000014813
Gene Namestanniocalcin 1
Synonyms
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location69029238-69041804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69031599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 72 (D72V)
Ref Sequence ENSEMBL: ENSMUSP00000014957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014957]
Predicted Effect probably damaging
Transcript: ENSMUST00000014957
AA Change: D72V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014957
Gene: ENSMUSG00000014813
AA Change: D72V

DomainStartEndE-ValueType
Pfam:Stanniocalcin 6 206 1.6e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224911
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Stc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Stc1 APN 14 69038277 missense probably benign 0.21
IGL01918:Stc1 APN 14 69031654 splice site probably benign
R0318:Stc1 UTSW 14 69038418 missense probably damaging 0.98
R0322:Stc1 UTSW 14 69029409 missense probably benign 0.08
R1699:Stc1 UTSW 14 69038327 missense probably benign 0.00
R2005:Stc1 UTSW 14 69031647 critical splice donor site probably null
R3801:Stc1 UTSW 14 69038475 missense probably benign
R3803:Stc1 UTSW 14 69038475 missense probably benign
R4184:Stc1 UTSW 14 69029385 start gained probably benign
R5927:Stc1 UTSW 14 69032373 missense probably benign 0.02
R6059:Stc1 UTSW 14 69032438 missense probably damaging 1.00
R6185:Stc1 UTSW 14 69038364 missense probably damaging 1.00
R7722:Stc1 UTSW 14 69032280 missense possibly damaging 0.76
R8001:Stc1 UTSW 14 69038395 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCCAAATCAAATTCCGAGGGTAAG -3'
(R):5'- ATGTTTGCAAGCCTGGGATG -3'

Sequencing Primer
(F):5'- AGATCATGTGCCCTTGGTATTAGAC -3'
(R):5'- CCTGGGATGAGCCTGGTTAGAAG -3'
Posted On2016-07-22