Incidental Mutation 'R5206:Csf2rb2'
ID402049
Institutional Source Beutler Lab
Gene Symbol Csf2rb2
Ensembl Gene ENSMUSG00000071714
Gene Namecolony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
SynonymsBil3, AIC2A, Il3r, Il3rb2, BetaIl3
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78282507-78305721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78292752 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 173 (I173L)
Ref Sequence ENSEMBL: ENSMUSP00000094083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096356] [ENSMUST00000230115]
PDB Structure
Extracellular domains of mouse IL-3 beta receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000096356
AA Change: I173L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094083
Gene: ENSMUSG00000071714
AA Change: I173L

DomainStartEndE-ValueType
SCOP:d1gh7a1 29 131 1e-57 SMART
FN3 137 225 3.73e-1 SMART
Pfam:IL6Ra-bind 248 342 6.3e-11 PFAM
FN3 343 425 2.83e0 SMART
transmembrane domain 445 467 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230115
Predicted Effect probably benign
Transcript: ENSMUST00000230753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230932
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Csf2rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Csf2rb2 APN 15 78284847 missense possibly damaging 0.78
IGL00765:Csf2rb2 APN 15 78292716 missense probably benign 0.17
IGL01383:Csf2rb2 APN 15 78297043 missense possibly damaging 0.90
IGL01975:Csf2rb2 APN 15 78288886 missense probably benign 0.01
IGL02330:Csf2rb2 APN 15 78285128 missense possibly damaging 0.85
IGL02365:Csf2rb2 APN 15 78287060 missense possibly damaging 0.92
IGL02756:Csf2rb2 APN 15 78284849 missense possibly damaging 0.95
R0269:Csf2rb2 UTSW 15 78288865 missense probably benign 0.09
R0462:Csf2rb2 UTSW 15 78285173 missense probably damaging 1.00
R0540:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0607:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0636:Csf2rb2 UTSW 15 78291960 nonsense probably null
R0782:Csf2rb2 UTSW 15 78286751 missense probably damaging 0.98
R1387:Csf2rb2 UTSW 15 78298214 missense probably damaging 0.99
R1799:Csf2rb2 UTSW 15 78297068 missense probably damaging 1.00
R1881:Csf2rb2 UTSW 15 78292535 intron probably null
R2079:Csf2rb2 UTSW 15 78288007 missense probably benign 0.13
R2108:Csf2rb2 UTSW 15 78292544 missense probably damaging 0.99
R2359:Csf2rb2 UTSW 15 78292776 missense probably benign 0.39
R4614:Csf2rb2 UTSW 15 78291702 missense probably damaging 1.00
R4806:Csf2rb2 UTSW 15 78285290 missense probably benign 0.11
R4900:Csf2rb2 UTSW 15 78285974 splice site probably null
R5270:Csf2rb2 UTSW 15 78291982 splice site probably null
R5427:Csf2rb2 UTSW 15 78288911 missense probably damaging 1.00
R6633:Csf2rb2 UTSW 15 78288952 missense probably benign 0.00
R7067:Csf2rb2 UTSW 15 78292494 missense probably damaging 1.00
R7102:Csf2rb2 UTSW 15 78297072 missense probably damaging 1.00
R7117:Csf2rb2 UTSW 15 78285185 missense probably damaging 1.00
R7423:Csf2rb2 UTSW 15 78292560 missense possibly damaging 0.65
R7453:Csf2rb2 UTSW 15 78285291 missense probably benign 0.14
R7705:Csf2rb2 UTSW 15 78284574 missense probably benign 0.02
R7788:Csf2rb2 UTSW 15 78292841 missense probably benign 0.12
R7849:Csf2rb2 UTSW 15 78284421 missense probably benign 0.09
R7851:Csf2rb2 UTSW 15 78288937 missense probably benign 0.10
R7932:Csf2rb2 UTSW 15 78284421 missense probably benign 0.09
R7934:Csf2rb2 UTSW 15 78288937 missense probably benign 0.10
R8057:Csf2rb2 UTSW 15 78285006 missense probably damaging 0.99
RF007:Csf2rb2 UTSW 15 78291926 missense probably benign 0.21
RF009:Csf2rb2 UTSW 15 78291927 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTTGGCTCTAAATTCACCTGAAAG -3'
(R):5'- GCATTTTGCAAGTTTCAGGC -3'

Sequencing Primer
(F):5'- CACCTGAAAGTTGCTAGTGTG -3'
(R):5'- TTCAGGCCTGAAGCTGAATG -3'
Posted On2016-07-22