Incidental Mutation 'R5206:Trim39'
ID402054
Institutional Source Beutler Lab
Gene Symbol Trim39
Ensembl Gene ENSMUSG00000045409
Gene Nametripartite motif-containing 39
SynonymsRnf23, RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, E130103K13Rik
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36258873-36272247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36260490 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 459 (Y459H)
Ref Sequence ENSEMBL: ENSMUSP00000133298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025319] [ENSMUST00000042717] [ENSMUST00000077535] [ENSMUST00000113706] [ENSMUST00000172573] [ENSMUST00000173369] [ENSMUST00000173665]
Predicted Effect probably benign
Transcript: ENSMUST00000025319
SMART Domains Protein: ENSMUSP00000025319
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 13 96 1.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042717
AA Change: Y451H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039790
Gene: ENSMUSG00000045409
AA Change: Y451H

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077535
SMART Domains Protein: ENSMUSP00000076739
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113704
Predicted Effect probably damaging
Transcript: ENSMUST00000113706
AA Change: Y451H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109336
Gene: ENSMUSG00000045409
AA Change: Y451H

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172573
SMART Domains Protein: ENSMUSP00000133400
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 1 48 4.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173122
Predicted Effect probably damaging
Transcript: ENSMUST00000173369
AA Change: Y459H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133298
Gene: ENSMUSG00000045409
AA Change: Y459H

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 314 367 1.23e-27 SMART
SPRY 368 493 1.95e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173486
Predicted Effect probably benign
Transcript: ENSMUST00000173665
SMART Domains Protein: ENSMUSP00000133529
Gene: ENSMUSG00000045409

DomainStartEndE-ValueType
BBOX 1 40 5.81e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174824
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Abcc2 T C 19: 43,818,150 V801A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Trim39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Trim39 APN 17 36263963 splice site probably benign
IGL01462:Trim39 APN 17 36263725 splice site probably benign
IGL02243:Trim39 APN 17 36260384 missense probably damaging 1.00
IGL03390:Trim39 APN 17 36260571 missense probably damaging 0.99
PIT4305001:Trim39 UTSW 17 36268970 missense possibly damaging 0.93
R0458:Trim39 UTSW 17 36261512 missense probably damaging 1.00
R0569:Trim39 UTSW 17 36263731 missense probably benign 0.36
R1565:Trim39 UTSW 17 36268854 missense probably damaging 1.00
R1769:Trim39 UTSW 17 36263940 missense probably damaging 1.00
R1969:Trim39 UTSW 17 36268753 missense probably benign 0.01
R2009:Trim39 UTSW 17 36263754 missense possibly damaging 0.92
R2568:Trim39 UTSW 17 36269164 unclassified probably benign
R5443:Trim39 UTSW 17 36260753 missense probably damaging 1.00
R6481:Trim39 UTSW 17 36268662 missense probably benign 0.03
R7132:Trim39 UTSW 17 36260655 missense probably benign 0.25
R7563:Trim39 UTSW 17 36260915 missense probably damaging 1.00
R7739:Trim39 UTSW 17 36260504 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGATGGCTCAAGACTGGAACC -3'
(R):5'- CACTTCCTGAGACTGGCTAC -3'

Sequencing Primer
(F):5'- CCAAGATATTCTAGCAGGCCAGTTAG -3'
(R):5'- TGAGACTGGCTACTGGCG -3'
Posted On2016-07-22