Mutagenetix > Incidental Mutations

Incidental Mutation 'R5206:Tmc1'

402057

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

042781-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20826660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 351 (N351S)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: N351S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: N351S

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,511	E487G	probably benign	Het
2610021A01Rik	A	T	7: 41,626,585	K571*	probably null	Het
4933415F23Rik	C	T	1: 23,102,102	G44R	probably benign	Het
A2m	T	C	6: 121,674,807	V1278A	probably damaging	Het
Abcc2	T	C	19: 43,818,150	V801A	probably damaging	Het
Acod1	T	A	14: 103,055,295	D418E	possibly damaging	Het
Bsn	G	A	9: 108,105,373	A3727V	unknown	Het
Cmah	T	G	13: 24,464,284	F501V	probably damaging	Het
Csf2rb2	T	A	15: 78,292,752	I173L	probably benign	Het
Dnah12	T	C	14: 26,769,985	W1126R	probably damaging	Het
Dock5	G	T	14: 67,763,184	A1690E	probably benign	Het
Dopey2	T	C	16: 93,801,584	L1879P	probably damaging	Het
Eif3j2	A	T	18: 43,477,582	D55E	probably benign	Het
Fam83f	G	A	15: 80,692,054	G302D	possibly damaging	Het
Fus	G	A	7: 127,969,797	G40D	unknown	Het
Glrp1	GTGCTGCTGCTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTGCTGCTGCTG	1: 88,503,275		probably benign	Het
Gxylt2	T	C	6: 100,804,615	V417A	probably damaging	Het
Hhipl1	G	A	12: 108,312,178	R255H	probably damaging	Het
Ints8	A	T	4: 11,216,477	I838N	possibly damaging	Het
Lama5	C	A	2: 180,191,304	C1579F	probably damaging	Het
Med13	C	T	11: 86,319,879	R479H	probably damaging	Het
Olfr1012	T	A	2: 85,759,623	Y251F	probably benign	Het
Olfr1467	G	T	19: 13,365,065	G146C	possibly damaging	Het
Olfr178	G	T	16: 58,890,018	N67K	probably damaging	Het
Olfr49	T	A	14: 54,282,698	M66L	probably benign	Het
Olfr610	A	T	7: 103,506,102	Y281*	probably null	Het
Pak6	A	G	2: 118,693,303	E313G	probably benign	Het
Pigs	T	A	11: 78,333,723	Y145N	probably damaging	Het
Pla2g2f	T	A	4: 138,752,351	D165V	probably benign	Het
Plbd1	C	T	6: 136,641,156	V133M	probably benign	Het
Ryr3	T	C	2: 112,844,711	Y1352C	probably damaging	Het
Scamp1	C	T	13: 94,232,107	R51H	probably damaging	Het
Slc2a2	G	A	3: 28,708,607	V100M	probably damaging	Het
Slc38a10	C	G	11: 120,105,062	A1062P	probably damaging	Het
Snai1	T	C	2: 167,538,968	I127T	probably benign	Het
Stat4	G	A	1: 52,105,236	G692D	probably damaging	Het
Stc1	A	T	14: 69,031,599	D72V	probably damaging	Het
Trim28	A	G	7: 13,025,348	I130V	probably benign	Het
Trim39	A	G	17: 36,260,490	Y459H	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ugt1a6b	C	A	1: 88,107,448	Y169*	probably null	Het
Vasp	T	C	7: 19,258,855		probably benign	Het
Vmn2r99	G	T	17: 19,378,606	G184V	probably benign	Het
Xrcc1	C	T	7: 24,567,563	T358I	probably damaging	Het
Zfp219	A	G	14: 52,009,565	V35A	probably benign	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATCCTTGTCTCACACTCAG -3'
(R):5'- ACGGAATGCACTTTACGGAATTTC -3'

Sequencing Primer
(F):5'- AGCAAGTCGCAGTTTCTTAGCAC -3'
(R):5'- GCACTTTACGGAATTTCAGATTTTAG -3'

Posted On

2016-07-22