Incidental Mutation 'R5206:Abcc2'
ID402058
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonymsmultidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission 042781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5206 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43782192-43840740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43818150 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 801 (V801A)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
Predicted Effect probably damaging
Transcript: ENSMUST00000026208
AA Change: V801A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: V801A

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146737
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,511 E487G probably benign Het
2610021A01Rik A T 7: 41,626,585 K571* probably null Het
4933415F23Rik C T 1: 23,102,102 G44R probably benign Het
A2m T C 6: 121,674,807 V1278A probably damaging Het
Acod1 T A 14: 103,055,295 D418E possibly damaging Het
Bsn G A 9: 108,105,373 A3727V unknown Het
Cmah T G 13: 24,464,284 F501V probably damaging Het
Csf2rb2 T A 15: 78,292,752 I173L probably benign Het
Dnah12 T C 14: 26,769,985 W1126R probably damaging Het
Dock5 G T 14: 67,763,184 A1690E probably benign Het
Dopey2 T C 16: 93,801,584 L1879P probably damaging Het
Eif3j2 A T 18: 43,477,582 D55E probably benign Het
Fam83f G A 15: 80,692,054 G302D possibly damaging Het
Fus G A 7: 127,969,797 G40D unknown Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gxylt2 T C 6: 100,804,615 V417A probably damaging Het
Hhipl1 G A 12: 108,312,178 R255H probably damaging Het
Ints8 A T 4: 11,216,477 I838N possibly damaging Het
Lama5 C A 2: 180,191,304 C1579F probably damaging Het
Med13 C T 11: 86,319,879 R479H probably damaging Het
Olfr1012 T A 2: 85,759,623 Y251F probably benign Het
Olfr1467 G T 19: 13,365,065 G146C possibly damaging Het
Olfr178 G T 16: 58,890,018 N67K probably damaging Het
Olfr49 T A 14: 54,282,698 M66L probably benign Het
Olfr610 A T 7: 103,506,102 Y281* probably null Het
Pak6 A G 2: 118,693,303 E313G probably benign Het
Pigs T A 11: 78,333,723 Y145N probably damaging Het
Pla2g2f T A 4: 138,752,351 D165V probably benign Het
Plbd1 C T 6: 136,641,156 V133M probably benign Het
Ryr3 T C 2: 112,844,711 Y1352C probably damaging Het
Scamp1 C T 13: 94,232,107 R51H probably damaging Het
Slc2a2 G A 3: 28,708,607 V100M probably damaging Het
Slc38a10 C G 11: 120,105,062 A1062P probably damaging Het
Snai1 T C 2: 167,538,968 I127T probably benign Het
Stat4 G A 1: 52,105,236 G692D probably damaging Het
Stc1 A T 14: 69,031,599 D72V probably damaging Het
Tmc1 T C 19: 20,826,660 N351S probably damaging Het
Trim28 A G 7: 13,025,348 I130V probably benign Het
Trim39 A G 17: 36,260,490 Y459H probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ugt1a6b C A 1: 88,107,448 Y169* probably null Het
Vasp T C 7: 19,258,855 probably benign Het
Vmn2r99 G T 17: 19,378,606 G184V probably benign Het
Xrcc1 C T 7: 24,567,563 T358I probably damaging Het
Zfp219 A G 14: 52,009,565 V35A probably benign Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 unclassified probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 utr 5 prime probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCCTTAGCAGGCTTGTAAAG -3'
(R):5'- GGGCCATGAGTTTCATAACGG -3'

Sequencing Primer
(F):5'- TTGTAAAGCAGGCCGAAG -3'
(R):5'- TTCATAACGGGGGCCTTCAAG -3'
Posted On2016-07-22