Incidental Mutation 'R5207:Whrn'
ID 402069
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms 1110035G07Rik, wi, Ush2d, Dfnb31, C430046P22Rik
MMRRC Submission 042782-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5207 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63333147-63414228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63350951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 15 (V15E)
Ref Sequence ENSEMBL: ENSMUSP00000114030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
AlphaFold Q80VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000063650
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063672
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084510
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095038
AA Change: V15E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102867
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect possibly damaging
Transcript: ENSMUST00000107393
AA Change: V461E

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: V461E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Predicted Effect probably damaging
Transcript: ENSMUST00000119294
AA Change: V15E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148957
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Meta Mutation Damage Score 0.6340 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,621,159 (GRCm39) probably benign Het
Alg6 C T 4: 99,607,431 (GRCm39) L15F possibly damaging Het
Allc T A 12: 28,605,325 (GRCm39) M325L probably benign Het
Ap3b2 T C 7: 81,126,517 (GRCm39) N361S possibly damaging Het
Bmp8b A G 4: 123,009,714 (GRCm39) probably benign Het
Borcs6 A T 11: 68,951,674 (GRCm39) T351S probably damaging Het
Ccar1 T C 10: 62,589,060 (GRCm39) R808G unknown Het
Celsr3 A T 9: 108,709,958 (GRCm39) T1480S probably benign Het
Chdh C T 14: 29,753,318 (GRCm39) P76S probably damaging Het
Chmp7 T C 14: 69,969,755 (GRCm39) S62G probably benign Het
Cldn23 A T 8: 36,293,182 (GRCm39) V102E probably damaging Het
Csn2 G A 5: 87,842,821 (GRCm39) Q69* probably null Het
Ctrc A C 4: 141,567,695 (GRCm39) I136S probably damaging Het
Cysltr2 A C 14: 73,266,951 (GRCm39) L253R probably damaging Het
Ddr2 G A 1: 169,812,530 (GRCm39) T654M probably damaging Het
Derl2 G T 11: 70,910,073 (GRCm39) probably null Het
Dnai7 A T 6: 145,124,794 (GRCm39) D510E probably damaging Het
Dock5 T C 14: 68,013,733 (GRCm39) S1330G probably benign Het
Emp3 T C 7: 45,569,373 (GRCm39) N56S probably benign Het
Fam161a A T 11: 22,970,583 (GRCm39) K195* probably null Het
Ficd T A 5: 113,875,072 (GRCm39) V47E probably benign Het
Garin3 T C 11: 46,295,990 (GRCm39) S121P probably benign Het
Gbp10 T C 5: 105,372,575 (GRCm39) T123A probably benign Het
Gdf7 C T 12: 8,348,371 (GRCm39) A309T unknown Het
Gm14486 G T 2: 30,548,572 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,307,151 (GRCm39) C990* probably null Het
Itgb4 T C 11: 115,897,365 (GRCm39) V1530A probably damaging Het
Itpka G A 2: 119,580,974 (GRCm39) R374H probably damaging Het
Lacc1 T A 14: 77,271,594 (GRCm39) probably null Het
Med23 A T 10: 24,771,734 (GRCm39) K225* probably null Het
Mrgpra3 T A 7: 47,239,909 (GRCm39) T6S probably benign Het
Mroh7 T A 4: 106,578,583 (GRCm39) N32Y probably damaging Het
Mrps2 A G 2: 28,359,763 (GRCm39) R207G probably damaging Het
Mup20 A C 4: 61,969,823 (GRCm39) probably null Het
Nagpa A G 16: 5,017,478 (GRCm39) probably null Het
Nek3 A T 8: 22,622,243 (GRCm39) probably benign Het
Nes G A 3: 87,885,935 (GRCm39) G1398E probably damaging Het
Nf1 G T 11: 79,345,015 (GRCm39) V1323L probably damaging Het
Or5b96 T A 19: 12,867,801 (GRCm39) I47F probably benign Het
Or6b2 A T 1: 92,407,594 (GRCm39) F250I probably benign Het
Or6c2 T C 10: 129,362,773 (GRCm39) F226L probably benign Het
Paqr8 G T 1: 21,005,482 (GRCm39) C212F probably benign Het
Pcdhb1 T C 18: 37,399,515 (GRCm39) Y489H probably damaging Het
Piwil2 T C 14: 70,629,966 (GRCm39) K683E probably damaging Het
Pjvk A C 2: 76,480,734 (GRCm39) probably null Het
Pkd1l3 A T 8: 110,359,823 (GRCm39) S893C probably damaging Het
Plxna2 A G 1: 194,471,207 (GRCm39) T993A probably benign Het
Ppp2r2b A T 18: 42,821,417 (GRCm39) I247N probably damaging Het
Rac2 T C 15: 78,449,654 (GRCm39) N92S probably damaging Het
Senp2 A T 16: 21,860,130 (GRCm39) H501L possibly damaging Het
Snx29 A T 16: 11,556,227 (GRCm39) I753F probably damaging Het
Tcf20 T A 15: 82,740,386 (GRCm39) H355L probably damaging Het
Tex2 T C 11: 106,437,666 (GRCm39) D668G unknown Het
Tlr12 G A 4: 128,510,502 (GRCm39) Q583* probably null Het
Tmem119 T C 5: 113,933,289 (GRCm39) I171V probably damaging Het
Ube2m C T 7: 12,770,249 (GRCm39) probably null Het
Vmn2r25 A T 6: 123,817,062 (GRCm39) I173N probably damaging Het
Zfp558 A C 9: 18,368,296 (GRCm39) V164G possibly damaging Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63,391,015 (GRCm39) missense probably damaging 1.00
IGL01643:Whrn APN 4 63,334,672 (GRCm39) missense possibly damaging 0.79
IGL02065:Whrn APN 4 63,336,822 (GRCm39) missense possibly damaging 0.52
IGL02119:Whrn APN 4 63,353,724 (GRCm39) missense probably damaging 0.99
IGL02589:Whrn APN 4 63,336,334 (GRCm39) nonsense probably null
IGL02638:Whrn APN 4 63,337,709 (GRCm39) missense possibly damaging 0.47
IGL02865:Whrn APN 4 63,333,729 (GRCm39) missense probably benign 0.08
IGL02934:Whrn APN 4 63,334,342 (GRCm39) missense probably damaging 1.00
IGL03372:Whrn APN 4 63,336,855 (GRCm39) missense probably damaging 0.96
R0090:Whrn UTSW 4 63,350,969 (GRCm39) missense possibly damaging 0.79
R0592:Whrn UTSW 4 63,333,804 (GRCm39) missense probably damaging 1.00
R0631:Whrn UTSW 4 63,337,726 (GRCm39) missense probably damaging 1.00
R1916:Whrn UTSW 4 63,412,969 (GRCm39) missense probably damaging 1.00
R1933:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R1958:Whrn UTSW 4 63,353,666 (GRCm39) missense possibly damaging 0.62
R2255:Whrn UTSW 4 63,336,385 (GRCm39) missense possibly damaging 0.92
R2513:Whrn UTSW 4 63,353,649 (GRCm39) missense probably benign 0.22
R3699:Whrn UTSW 4 63,379,649 (GRCm39) splice site probably benign
R3919:Whrn UTSW 4 63,413,421 (GRCm39) nonsense probably null
R4016:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R4241:Whrn UTSW 4 63,351,210 (GRCm39) unclassified probably benign
R4517:Whrn UTSW 4 63,379,517 (GRCm39) critical splice donor site probably null
R4739:Whrn UTSW 4 63,336,402 (GRCm39) missense probably damaging 1.00
R5281:Whrn UTSW 4 63,336,664 (GRCm39) missense probably benign 0.04
R5307:Whrn UTSW 4 63,350,080 (GRCm39) missense probably benign 0.01
R5463:Whrn UTSW 4 63,351,053 (GRCm39) missense probably benign 0.08
R5663:Whrn UTSW 4 63,336,685 (GRCm39) missense probably damaging 0.98
R5754:Whrn UTSW 4 63,334,825 (GRCm39) missense probably damaging 0.98
R5933:Whrn UTSW 4 63,412,945 (GRCm39) missense probably damaging 1.00
R6212:Whrn UTSW 4 63,412,923 (GRCm39) nonsense probably null
R6380:Whrn UTSW 4 63,336,829 (GRCm39) missense possibly damaging 0.90
R6381:Whrn UTSW 4 63,390,921 (GRCm39) missense probably benign 0.00
R7030:Whrn UTSW 4 63,413,368 (GRCm39) unclassified probably benign
R7350:Whrn UTSW 4 63,350,196 (GRCm39) missense possibly damaging 0.71
R7382:Whrn UTSW 4 63,336,573 (GRCm39) missense probably benign
R7419:Whrn UTSW 4 63,334,330 (GRCm39) missense possibly damaging 0.94
R8334:Whrn UTSW 4 63,413,047 (GRCm39) missense probably damaging 1.00
R9378:Whrn UTSW 4 63,350,079 (GRCm39) missense probably benign 0.00
X0009:Whrn UTSW 4 63,350,148 (GRCm39) missense probably benign 0.00
Z1176:Whrn UTSW 4 63,333,803 (GRCm39) missense probably damaging 1.00
Z1177:Whrn UTSW 4 63,336,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGACTTCTTCTACCTGAGC -3'
(R):5'- TTCAGCCAGGATTTTACAAGGG -3'

Sequencing Primer
(F):5'- CCCTGATGCCTGCTTGTGAAG -3'
(R):5'- CCAGGATTTTACAAGGGCCCAG -3'
Posted On 2016-07-22