Incidental Mutation 'R5207:Whrn'
ID 402069
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms C430046P22Rik, Dfnb31, wi, 1110035G07Rik
MMRRC Submission 042782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5207 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63414910-63495991 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63432714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 15 (V15E)
Ref Sequence ENSEMBL: ENSMUSP00000114030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
AlphaFold Q80VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000063650
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063672
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084510
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095038
AA Change: V15E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102867
AA Change: V457E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: V457E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107393
AA Change: V461E

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: V461E

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119294
AA Change: V15E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148957
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Meta Mutation Damage Score 0.6340 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,793,594 probably benign Het
Alg6 C T 4: 99,719,194 L15F possibly damaging Het
Allc T A 12: 28,555,326 M325L probably benign Het
Ap3b2 T C 7: 81,476,769 N361S possibly damaging Het
Bmp8b A G 4: 123,115,921 probably benign Het
Borcs6 A T 11: 69,060,848 T351S probably damaging Het
Casc1 A T 6: 145,179,068 D510E probably damaging Het
Ccar1 T C 10: 62,753,281 R808G unknown Het
Celsr3 A T 9: 108,832,759 T1480S probably benign Het
Chdh C T 14: 30,031,361 P76S probably damaging Het
Chmp7 T C 14: 69,732,306 S62G probably benign Het
Cldn23 A T 8: 35,826,028 V102E probably damaging Het
Csn2 G A 5: 87,694,962 Q69* probably null Het
Ctrc A C 4: 141,840,384 I136S probably damaging Het
Cysltr2 A C 14: 73,029,511 L253R probably damaging Het
Ddr2 G A 1: 169,984,961 T654M probably damaging Het
Derl2 G T 11: 71,019,247 probably null Het
Dock5 T C 14: 67,776,284 S1330G probably benign Het
Emp3 T C 7: 45,919,949 N56S probably benign Het
Fam161a A T 11: 23,020,583 K195* probably null Het
Fam71b T C 11: 46,405,163 S121P probably benign Het
Ficd T A 5: 113,737,011 V47E probably benign Het
Gbp10 T C 5: 105,224,709 T123A probably benign Het
Gdf7 C T 12: 8,298,371 A309T unknown Het
Gm14486 G T 2: 30,658,560 noncoding transcript Het
Herc1 T A 9: 66,399,869 C990* probably null Het
Itgb4 T C 11: 116,006,539 V1530A probably damaging Het
Itpka G A 2: 119,750,493 R374H probably damaging Het
Lacc1 T A 14: 77,034,154 probably null Het
Med23 A T 10: 24,895,836 K225* probably null Het
Mrgpra3 T A 7: 47,590,161 T6S probably benign Het
Mroh7 T A 4: 106,721,386 N32Y probably damaging Het
Mrps2 A G 2: 28,469,751 R207G probably damaging Het
Mup20 A C 4: 62,051,586 probably null Het
Nagpa A G 16: 5,199,614 probably null Het
Nek3 A T 8: 22,132,227 probably benign Het
Nes G A 3: 87,978,628 G1398E probably damaging Het
Nf1 G T 11: 79,454,189 V1323L probably damaging Het
Olfr1416 A T 1: 92,479,872 F250I probably benign Het
Olfr1446 T A 19: 12,890,437 I47F probably benign Het
Olfr791 T C 10: 129,526,904 F226L probably benign Het
Paqr8 G T 1: 20,935,258 C212F probably benign Het
Pcdhb1 T C 18: 37,266,462 Y489H probably damaging Het
Piwil2 T C 14: 70,392,517 K683E probably damaging Het
Pjvk A C 2: 76,650,390 probably null Het
Pkd1l3 A T 8: 109,633,191 S893C probably damaging Het
Plxna2 A G 1: 194,788,899 T993A probably benign Het
Ppp2r2b A T 18: 42,688,352 I247N probably damaging Het
Rac2 T C 15: 78,565,454 N92S probably damaging Het
Senp2 A T 16: 22,041,380 H501L possibly damaging Het
Snx29 A T 16: 11,738,363 I753F probably damaging Het
Tcf20 T A 15: 82,856,185 H355L probably damaging Het
Tex2 T C 11: 106,546,840 D668G unknown Het
Tlr12 G A 4: 128,616,709 Q583* probably null Het
Tmem119 T C 5: 113,795,228 I171V probably damaging Het
Ube2m C T 7: 13,036,322 probably null Het
Vmn2r25 A T 6: 123,840,103 I173N probably damaging Het
Zfp558 A C 9: 18,457,000 V164G possibly damaging Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R0631:Whrn UTSW 4 63419489 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5307:Whrn UTSW 4 63431843 missense probably benign 0.01
R5463:Whrn UTSW 4 63432816 missense probably benign 0.08
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6212:Whrn UTSW 4 63494686 nonsense probably null
R6380:Whrn UTSW 4 63418592 missense possibly damaging 0.90
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
R8334:Whrn UTSW 4 63494810 missense probably damaging 1.00
R9378:Whrn UTSW 4 63431842 missense probably benign 0.00
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Z1176:Whrn UTSW 4 63415566 missense probably damaging 1.00
Z1177:Whrn UTSW 4 63418499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGACTTCTTCTACCTGAGC -3'
(R):5'- TTCAGCCAGGATTTTACAAGGG -3'

Sequencing Primer
(F):5'- CCCTGATGCCTGCTTGTGAAG -3'
(R):5'- CCAGGATTTTACAAGGGCCCAG -3'
Posted On 2016-07-22