Incidental Mutation 'R5207:Dnai7'
ID 402079
Institutional Source Beutler Lab
Gene Symbol Dnai7
Ensembl Gene ENSMUSG00000043541
Gene Name dynein axonemal intermediate chain 7
Synonyms Las1, A230084G12Rik, Casc1
MMRRC Submission 042782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5207 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 145120560-145156731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 145124794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 510 (D510E)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: D510E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: D510E

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: D497E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: D497E

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141307
Predicted Effect probably damaging
Transcript: ENSMUST00000204105
AA Change: D510E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: D510E

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Meta Mutation Damage Score 0.2461 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,621,159 (GRCm39) probably benign Het
Alg6 C T 4: 99,607,431 (GRCm39) L15F possibly damaging Het
Allc T A 12: 28,605,325 (GRCm39) M325L probably benign Het
Ap3b2 T C 7: 81,126,517 (GRCm39) N361S possibly damaging Het
Bmp8b A G 4: 123,009,714 (GRCm39) probably benign Het
Borcs6 A T 11: 68,951,674 (GRCm39) T351S probably damaging Het
Ccar1 T C 10: 62,589,060 (GRCm39) R808G unknown Het
Celsr3 A T 9: 108,709,958 (GRCm39) T1480S probably benign Het
Chdh C T 14: 29,753,318 (GRCm39) P76S probably damaging Het
Chmp7 T C 14: 69,969,755 (GRCm39) S62G probably benign Het
Cldn23 A T 8: 36,293,182 (GRCm39) V102E probably damaging Het
Csn2 G A 5: 87,842,821 (GRCm39) Q69* probably null Het
Ctrc A C 4: 141,567,695 (GRCm39) I136S probably damaging Het
Cysltr2 A C 14: 73,266,951 (GRCm39) L253R probably damaging Het
Ddr2 G A 1: 169,812,530 (GRCm39) T654M probably damaging Het
Derl2 G T 11: 70,910,073 (GRCm39) probably null Het
Dock5 T C 14: 68,013,733 (GRCm39) S1330G probably benign Het
Emp3 T C 7: 45,569,373 (GRCm39) N56S probably benign Het
Fam161a A T 11: 22,970,583 (GRCm39) K195* probably null Het
Ficd T A 5: 113,875,072 (GRCm39) V47E probably benign Het
Garin3 T C 11: 46,295,990 (GRCm39) S121P probably benign Het
Gbp10 T C 5: 105,372,575 (GRCm39) T123A probably benign Het
Gdf7 C T 12: 8,348,371 (GRCm39) A309T unknown Het
Gm14486 G T 2: 30,548,572 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,307,151 (GRCm39) C990* probably null Het
Itgb4 T C 11: 115,897,365 (GRCm39) V1530A probably damaging Het
Itpka G A 2: 119,580,974 (GRCm39) R374H probably damaging Het
Lacc1 T A 14: 77,271,594 (GRCm39) probably null Het
Med23 A T 10: 24,771,734 (GRCm39) K225* probably null Het
Mrgpra3 T A 7: 47,239,909 (GRCm39) T6S probably benign Het
Mroh7 T A 4: 106,578,583 (GRCm39) N32Y probably damaging Het
Mrps2 A G 2: 28,359,763 (GRCm39) R207G probably damaging Het
Mup20 A C 4: 61,969,823 (GRCm39) probably null Het
Nagpa A G 16: 5,017,478 (GRCm39) probably null Het
Nek3 A T 8: 22,622,243 (GRCm39) probably benign Het
Nes G A 3: 87,885,935 (GRCm39) G1398E probably damaging Het
Nf1 G T 11: 79,345,015 (GRCm39) V1323L probably damaging Het
Or5b96 T A 19: 12,867,801 (GRCm39) I47F probably benign Het
Or6b2 A T 1: 92,407,594 (GRCm39) F250I probably benign Het
Or6c2 T C 10: 129,362,773 (GRCm39) F226L probably benign Het
Paqr8 G T 1: 21,005,482 (GRCm39) C212F probably benign Het
Pcdhb1 T C 18: 37,399,515 (GRCm39) Y489H probably damaging Het
Piwil2 T C 14: 70,629,966 (GRCm39) K683E probably damaging Het
Pjvk A C 2: 76,480,734 (GRCm39) probably null Het
Pkd1l3 A T 8: 110,359,823 (GRCm39) S893C probably damaging Het
Plxna2 A G 1: 194,471,207 (GRCm39) T993A probably benign Het
Ppp2r2b A T 18: 42,821,417 (GRCm39) I247N probably damaging Het
Rac2 T C 15: 78,449,654 (GRCm39) N92S probably damaging Het
Senp2 A T 16: 21,860,130 (GRCm39) H501L possibly damaging Het
Snx29 A T 16: 11,556,227 (GRCm39) I753F probably damaging Het
Tcf20 T A 15: 82,740,386 (GRCm39) H355L probably damaging Het
Tex2 T C 11: 106,437,666 (GRCm39) D668G unknown Het
Tlr12 G A 4: 128,510,502 (GRCm39) Q583* probably null Het
Tmem119 T C 5: 113,933,289 (GRCm39) I171V probably damaging Het
Ube2m C T 7: 12,770,249 (GRCm39) probably null Het
Vmn2r25 A T 6: 123,817,062 (GRCm39) I173N probably damaging Het
Whrn A T 4: 63,350,951 (GRCm39) V15E probably damaging Het
Zfp558 A C 9: 18,368,296 (GRCm39) V164G possibly damaging Het
Other mutations in Dnai7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnai7 APN 6 145,121,016 (GRCm39) missense probably benign 0.00
IGL00586:Dnai7 APN 6 145,137,302 (GRCm39) missense possibly damaging 0.53
IGL01066:Dnai7 APN 6 145,121,948 (GRCm39) missense probably damaging 0.96
IGL01413:Dnai7 APN 6 145,120,812 (GRCm39) missense probably damaging 1.00
IGL02275:Dnai7 APN 6 145,123,090 (GRCm39) missense probably damaging 1.00
IGL02668:Dnai7 APN 6 145,150,983 (GRCm39) missense unknown
IGL03018:Dnai7 APN 6 145,129,031 (GRCm39) missense probably damaging 1.00
IGL03233:Dnai7 APN 6 145,127,611 (GRCm39) missense probably damaging 1.00
R0011:Dnai7 UTSW 6 145,124,781 (GRCm39) missense probably damaging 1.00
R0011:Dnai7 UTSW 6 145,124,781 (GRCm39) missense probably damaging 1.00
R0180:Dnai7 UTSW 6 145,128,944 (GRCm39) critical splice donor site probably benign
R0786:Dnai7 UTSW 6 145,127,483 (GRCm39) critical splice donor site probably null
R1916:Dnai7 UTSW 6 145,121,926 (GRCm39) missense probably benign 0.37
R2117:Dnai7 UTSW 6 145,150,967 (GRCm39) critical splice donor site probably null
R2174:Dnai7 UTSW 6 145,120,896 (GRCm39) missense probably damaging 1.00
R2264:Dnai7 UTSW 6 145,154,155 (GRCm39) utr 5 prime probably benign
R4393:Dnai7 UTSW 6 145,140,304 (GRCm39) missense possibly damaging 0.49
R4467:Dnai7 UTSW 6 145,128,944 (GRCm39) critical splice donor site probably null
R4847:Dnai7 UTSW 6 145,120,911 (GRCm39) missense probably damaging 1.00
R5014:Dnai7 UTSW 6 145,128,992 (GRCm39) missense probably damaging 1.00
R5264:Dnai7 UTSW 6 145,127,502 (GRCm39) missense probably benign 0.02
R5359:Dnai7 UTSW 6 145,142,618 (GRCm39) missense probably damaging 1.00
R5499:Dnai7 UTSW 6 145,123,157 (GRCm39) missense probably damaging 1.00
R6211:Dnai7 UTSW 6 145,146,217 (GRCm39) missense probably damaging 1.00
R6579:Dnai7 UTSW 6 145,124,744 (GRCm39) missense probably benign 0.19
R6939:Dnai7 UTSW 6 145,120,945 (GRCm39) missense possibly damaging 0.46
R7108:Dnai7 UTSW 6 145,131,591 (GRCm39) nonsense probably null
R7131:Dnai7 UTSW 6 145,123,132 (GRCm39) missense probably null 0.97
R7810:Dnai7 UTSW 6 145,140,312 (GRCm39) missense probably benign 0.28
R8017:Dnai7 UTSW 6 145,140,283 (GRCm39) missense probably damaging 1.00
R8385:Dnai7 UTSW 6 145,120,918 (GRCm39) missense probably damaging 1.00
R8680:Dnai7 UTSW 6 145,127,542 (GRCm39) missense probably benign 0.13
R8720:Dnai7 UTSW 6 145,150,983 (GRCm39) missense unknown
R9118:Dnai7 UTSW 6 145,120,971 (GRCm39) missense probably damaging 1.00
R9118:Dnai7 UTSW 6 145,120,900 (GRCm39) missense probably damaging 1.00
R9172:Dnai7 UTSW 6 145,123,175 (GRCm39) missense probably benign
R9290:Dnai7 UTSW 6 145,148,688 (GRCm39) missense unknown
X0063:Dnai7 UTSW 6 145,120,997 (GRCm39) missense probably benign 0.13
Z1176:Dnai7 UTSW 6 145,151,019 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTACATGCCTGCCTGG -3'
(R):5'- GGAGCTTTTCCTCACGTGTC -3'

Sequencing Primer
(F):5'- TGGGGACACACTGCCTAACTATG -3'
(R):5'- TCCTCACGTGTCTTAATACAGAAAAC -3'
Posted On 2016-07-22