Mutagenetix > Incidental Mutations

Incidental Mutation 'R0415:Cst9'

40208

Institutional Source

Beutler Lab

Gene Symbol

Cst9

Ensembl Gene

ENSMUSG00000027445

Gene Name

cystatin 9

Synonyms

M12, cresp, testatin

MMRRC Submission

038617-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0415 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

148835147-148838738 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 148838442 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028935 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028935]

Predicted Effect

probably benign
Transcript: ENSMUST00000028935

SMART Domains

Protein: ENSMUSP00000028935
Gene: ENSMUSG00000027445

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
CY	27	137	2.38e-2	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (99/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to mouse cystatin 9. Based on its testis-specific expression, it is likely to have a role in tissue reorganization during early testis development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes are viable and fertile with normal testes development and morphology, sperm numbers and motility, and serum levels of testosterone, luteinizing hormone, and follicle-stimulating hormone. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427G23Rik	A	T	5: 23,831,050		noncoding transcript	Het
Acox2	A	G	14: 8,243,835		probably benign	Het
Adgb	T	C	10: 10,431,067		probably null	Het
Adgra3	C	A	5: 49,961,757		probably benign	Het
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ahnak	A	G	19: 9,012,871		probably benign	Het
Anapc2	A	G	2: 25,278,325	T159A	probably damaging	Het
Arfgef3	A	G	10: 18,613,127		probably benign	Het
Atf7ip	C	T	6: 136,560,012	S81L	possibly damaging	Het
Cacna1i	A	G	15: 80,368,830		probably benign	Het
Camk1	A	T	6: 113,341,891	Y20*	probably null	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
Cd109	T	A	9: 78,712,615	S1380T	probably benign	Het
Cfap57	A	T	4: 118,569,431	L1107Q	possibly damaging	Het
Col6a4	C	T	9: 106,075,080	V540I	probably damaging	Het
Cul5	C	T	9: 53,667,070	V73I	probably benign	Het
Cxcl16	T	A	11: 70,458,748	K84*	probably null	Het
Cyp2c29	T	C	19: 39,329,095		probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dip2c	C	T	13: 9,568,289		probably benign	Het
Dis3	A	T	14: 99,087,456	I513N	probably damaging	Het
Dnajc16	A	T	4: 141,789,048	L3*	probably null	Het
Dopey1	T	A	9: 86,506,502	L480M	probably damaging	Het
Eml6	A	G	11: 29,749,392	V1787A	possibly damaging	Het
Etnk1	A	G	6: 143,180,774	N115S	probably damaging	Het
Fryl	T	C	5: 73,098,414	Y758C	probably damaging	Het
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Ggnbp2	A	C	11: 84,833,225		probably benign	Het
Gm7137	A	G	10: 77,788,173		probably benign	Het
Gstm2	T	A	3: 107,984,006	Q132L	probably benign	Het
Habp2	T	C	19: 56,317,717		probably benign	Het
Hectd2	T	C	19: 36,584,884		probably benign	Het
Htr6	A	G	4: 139,062,081	I291T	possibly damaging	Het
Ighg2c	T	C	12: 113,287,910	D199G	unknown	Het
Itih2	A	G	2: 10,105,615		probably benign	Het
Kcnab2	A	G	4: 152,395,136	F248S	probably benign	Het
Kcnc4	T	C	3: 107,445,433	K610E	probably damaging	Het
Kcnk16	T	A	14: 20,262,975		probably null	Het
Kndc1	C	T	7: 139,930,124	T1293I	probably damaging	Het
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Lrrc8d	T	C	5: 105,811,865	L47P	probably damaging	Het
Lyst	T	C	13: 13,711,610		probably benign	Het
Macrod2	G	A	2: 142,210,145		probably null	Het
Micalcl	C	T	7: 112,381,028	R70C	probably damaging	Het
Mllt3	ACTGCTGCTGCTGCTGCTGCT	ACTGCTGCTGCTGCTGCT	4: 87,841,339		probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nup205	T	C	6: 35,214,634		probably benign	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Olfr229	A	G	9: 39,909,983	Y60C	probably damaging	Het
Olfr78	C	T	7: 102,742,087	M305I	probably benign	Het
Olfr893	A	T	9: 38,209,973	M305L	probably benign	Het
Pard3	G	A	8: 127,610,566	G1221D	probably damaging	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Pcsk6	C	T	7: 66,033,874	R746C	probably damaging	Het
Pif1	G	A	9: 65,588,051	C81Y	probably benign	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plcd4	C	A	1: 74,552,097	S217Y	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Het
Polr2k	A	G	15: 36,175,456	Y45C	probably damaging	Het
Pqlc3	C	A	12: 16,997,710		probably benign	Het
Prex1	A	G	2: 166,586,699		probably benign	Het
Pth2r	A	G	1: 65,388,439	M424V	probably benign	Het
Pygm	A	G	19: 6,391,366	R464G	probably benign	Het
Rad51c	A	G	11: 87,397,655	L234P	probably damaging	Het
Rnf145	A	G	11: 44,525,138	Y60C	probably damaging	Het
Rnf167	T	C	11: 70,649,699	I135T	probably damaging	Het
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Het
Selenbp1	T	C	3: 94,936,913	V27A	possibly damaging	Het
Selenof	T	G	3: 144,577,692	L14R	probably damaging	Het
Sfswap	A	T	5: 129,504,126	D121V	probably damaging	Het
Slc25a34	C	A	4: 141,620,469	M300I	possibly damaging	Het
Slc34a3	T	G	2: 25,229,110	T583P	probably benign	Het
Smg1	C	A	7: 118,182,468	A1199S	probably benign	Het
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Sptbn1	A	C	11: 30,149,576	N229K	probably damaging	Het
Sult2b1	A	G	7: 45,730,092		probably benign	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem132c	A	G	5: 127,563,705	E980G	probably damaging	Het
Tmem247	G	T	17: 86,922,322	C197F	probably damaging	Het
Tmem251	T	A	12: 102,744,876	Y119*	probably null	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Het
Tmprss13	A	G	9: 45,337,132		probably null	Het
Trove2	G	T	1: 143,760,075	N444K	probably benign	Het
Ubr5	T	C	15: 37,972,980	T2626A	probably damaging	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Het
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Het
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Vmn2r74	A	C	7: 85,961,410	C25G	probably damaging	Het
Xndc1	T	C	7: 102,080,616		probably benign	Het
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Het
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Het
Zfp316	T	A	5: 143,264,491	T56S	unknown	Het
Zfp345	A	G	2: 150,474,559		probably benign	Het

Other mutations in Cst9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01796:Cst9	APN	2	148835349	missense	probably damaging	1.00
IGL02851:Cst9	APN	2	148835283	missense	probably benign	0.29
R2973:Cst9	UTSW	2	148835225	splice site	probably null
R5826:Cst9	UTSW	2	148838473	missense	possibly damaging	0.75
R8183:Cst9	UTSW	2	148836714	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GACGCAAGTCAATATTTGCCAAGGG -3'
(R):5'- GAAACTCAAATTGTCCGCACCACTG -3'

Sequencing Primer
(F):5'- CAATATTTGCCAAGGGTTCACTGG -3'
(R):5'- CCAGTCTTGATACTGCACAATG -3'

Posted On

2013-05-23