Incidental Mutation 'R5207:Ap3b2'
ID 402083
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 042782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R5207 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81126517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 361 (N361S)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect possibly damaging
Transcript: ENSMUST00000082090
AA Change: N361S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: N361S

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119121
SMART Domains Protein: ENSMUSP00000114032
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 122 5.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125634
Predicted Effect probably benign
Transcript: ENSMUST00000152355
AA Change: N361S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,621,159 (GRCm39) probably benign Het
Alg6 C T 4: 99,607,431 (GRCm39) L15F possibly damaging Het
Allc T A 12: 28,605,325 (GRCm39) M325L probably benign Het
Bmp8b A G 4: 123,009,714 (GRCm39) probably benign Het
Borcs6 A T 11: 68,951,674 (GRCm39) T351S probably damaging Het
Ccar1 T C 10: 62,589,060 (GRCm39) R808G unknown Het
Celsr3 A T 9: 108,709,958 (GRCm39) T1480S probably benign Het
Chdh C T 14: 29,753,318 (GRCm39) P76S probably damaging Het
Chmp7 T C 14: 69,969,755 (GRCm39) S62G probably benign Het
Cldn23 A T 8: 36,293,182 (GRCm39) V102E probably damaging Het
Csn2 G A 5: 87,842,821 (GRCm39) Q69* probably null Het
Ctrc A C 4: 141,567,695 (GRCm39) I136S probably damaging Het
Cysltr2 A C 14: 73,266,951 (GRCm39) L253R probably damaging Het
Ddr2 G A 1: 169,812,530 (GRCm39) T654M probably damaging Het
Derl2 G T 11: 70,910,073 (GRCm39) probably null Het
Dnai7 A T 6: 145,124,794 (GRCm39) D510E probably damaging Het
Dock5 T C 14: 68,013,733 (GRCm39) S1330G probably benign Het
Emp3 T C 7: 45,569,373 (GRCm39) N56S probably benign Het
Fam161a A T 11: 22,970,583 (GRCm39) K195* probably null Het
Ficd T A 5: 113,875,072 (GRCm39) V47E probably benign Het
Garin3 T C 11: 46,295,990 (GRCm39) S121P probably benign Het
Gbp10 T C 5: 105,372,575 (GRCm39) T123A probably benign Het
Gdf7 C T 12: 8,348,371 (GRCm39) A309T unknown Het
Gm14486 G T 2: 30,548,572 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,307,151 (GRCm39) C990* probably null Het
Itgb4 T C 11: 115,897,365 (GRCm39) V1530A probably damaging Het
Itpka G A 2: 119,580,974 (GRCm39) R374H probably damaging Het
Lacc1 T A 14: 77,271,594 (GRCm39) probably null Het
Med23 A T 10: 24,771,734 (GRCm39) K225* probably null Het
Mrgpra3 T A 7: 47,239,909 (GRCm39) T6S probably benign Het
Mroh7 T A 4: 106,578,583 (GRCm39) N32Y probably damaging Het
Mrps2 A G 2: 28,359,763 (GRCm39) R207G probably damaging Het
Mup20 A C 4: 61,969,823 (GRCm39) probably null Het
Nagpa A G 16: 5,017,478 (GRCm39) probably null Het
Nek3 A T 8: 22,622,243 (GRCm39) probably benign Het
Nes G A 3: 87,885,935 (GRCm39) G1398E probably damaging Het
Nf1 G T 11: 79,345,015 (GRCm39) V1323L probably damaging Het
Or5b96 T A 19: 12,867,801 (GRCm39) I47F probably benign Het
Or6b2 A T 1: 92,407,594 (GRCm39) F250I probably benign Het
Or6c2 T C 10: 129,362,773 (GRCm39) F226L probably benign Het
Paqr8 G T 1: 21,005,482 (GRCm39) C212F probably benign Het
Pcdhb1 T C 18: 37,399,515 (GRCm39) Y489H probably damaging Het
Piwil2 T C 14: 70,629,966 (GRCm39) K683E probably damaging Het
Pjvk A C 2: 76,480,734 (GRCm39) probably null Het
Pkd1l3 A T 8: 110,359,823 (GRCm39) S893C probably damaging Het
Plxna2 A G 1: 194,471,207 (GRCm39) T993A probably benign Het
Ppp2r2b A T 18: 42,821,417 (GRCm39) I247N probably damaging Het
Rac2 T C 15: 78,449,654 (GRCm39) N92S probably damaging Het
Senp2 A T 16: 21,860,130 (GRCm39) H501L possibly damaging Het
Snx29 A T 16: 11,556,227 (GRCm39) I753F probably damaging Het
Tcf20 T A 15: 82,740,386 (GRCm39) H355L probably damaging Het
Tex2 T C 11: 106,437,666 (GRCm39) D668G unknown Het
Tlr12 G A 4: 128,510,502 (GRCm39) Q583* probably null Het
Tmem119 T C 5: 113,933,289 (GRCm39) I171V probably damaging Het
Ube2m C T 7: 12,770,249 (GRCm39) probably null Het
Vmn2r25 A T 6: 123,817,062 (GRCm39) I173N probably damaging Het
Whrn A T 4: 63,350,951 (GRCm39) V15E probably damaging Het
Zfp558 A C 9: 18,368,296 (GRCm39) V164G possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCCCTTCAGGATCTAG -3'
(R):5'- TACTTCCACCTAGCGCCTAAG -3'

Sequencing Primer
(F):5'- TTCAGGATCTAGACCCGGCTC -3'
(R):5'- CACAGGTACAGAGAGCCCTG -3'
Posted On 2016-07-22