Mutagenetix > Incidental Mutation

Incidental Mutation 'R5207:Ap3b2'

402083

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

042782-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5207 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81476769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 361 (N361S)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082090
AA Change: N361S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: N361S

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119121

SMART Domains

Protein: ENSMUSP00000114032
Gene: ENSMUSG00000062444

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	122	5.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125634

Predicted Effect

probably benign
Transcript: ENSMUST00000152355
AA Change: N361S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahctf1	A	T	1: 179,793,594		probably benign	Het
Alg6	C	T	4: 99,719,194	L15F	possibly damaging	Het
Allc	T	A	12: 28,555,326	M325L	probably benign	Het
Bmp8b	A	G	4: 123,115,921		probably benign	Het
Borcs6	A	T	11: 69,060,848	T351S	probably damaging	Het
Casc1	A	T	6: 145,179,068	D510E	probably damaging	Het
Ccar1	T	C	10: 62,753,281	R808G	unknown	Het
Celsr3	A	T	9: 108,832,759	T1480S	probably benign	Het
Chdh	C	T	14: 30,031,361	P76S	probably damaging	Het
Chmp7	T	C	14: 69,732,306	S62G	probably benign	Het
Cldn23	A	T	8: 35,826,028	V102E	probably damaging	Het
Csn2	G	A	5: 87,694,962	Q69*	probably null	Het
Ctrc	A	C	4: 141,840,384	I136S	probably damaging	Het
Cysltr2	A	C	14: 73,029,511	L253R	probably damaging	Het
Ddr2	G	A	1: 169,984,961	T654M	probably damaging	Het
Derl2	G	T	11: 71,019,247		probably null	Het
Dock5	T	C	14: 67,776,284	S1330G	probably benign	Het
Emp3	T	C	7: 45,919,949	N56S	probably benign	Het
Fam161a	A	T	11: 23,020,583	K195*	probably null	Het
Fam71b	T	C	11: 46,405,163	S121P	probably benign	Het
Ficd	T	A	5: 113,737,011	V47E	probably benign	Het
Gbp10	T	C	5: 105,224,709	T123A	probably benign	Het
Gdf7	C	T	12: 8,298,371	A309T	unknown	Het
Gm14486	G	T	2: 30,658,560		noncoding transcript	Het
Herc1	T	A	9: 66,399,869	C990*	probably null	Het
Itgb4	T	C	11: 116,006,539	V1530A	probably damaging	Het
Itpka	G	A	2: 119,750,493	R374H	probably damaging	Het
Lacc1	T	A	14: 77,034,154		probably null	Het
Med23	A	T	10: 24,895,836	K225*	probably null	Het
Mrgpra3	T	A	7: 47,590,161	T6S	probably benign	Het
Mroh7	T	A	4: 106,721,386	N32Y	probably damaging	Het
Mrps2	A	G	2: 28,469,751	R207G	probably damaging	Het
Mup20	A	C	4: 62,051,586		probably null	Het
Nagpa	A	G	16: 5,199,614		probably null	Het
Nek3	A	T	8: 22,132,227		probably benign	Het
Nes	G	A	3: 87,978,628	G1398E	probably damaging	Het
Nf1	G	T	11: 79,454,189	V1323L	probably damaging	Het
Olfr1416	A	T	1: 92,479,872	F250I	probably benign	Het
Olfr1446	T	A	19: 12,890,437	I47F	probably benign	Het
Olfr791	T	C	10: 129,526,904	F226L	probably benign	Het
Paqr8	G	T	1: 20,935,258	C212F	probably benign	Het
Pcdhb1	T	C	18: 37,266,462	Y489H	probably damaging	Het
Piwil2	T	C	14: 70,392,517	K683E	probably damaging	Het
Pjvk	A	C	2: 76,650,390		probably null	Het
Pkd1l3	A	T	8: 109,633,191	S893C	probably damaging	Het
Plxna2	A	G	1: 194,788,899	T993A	probably benign	Het
Ppp2r2b	A	T	18: 42,688,352	I247N	probably damaging	Het
Rac2	T	C	15: 78,565,454	N92S	probably damaging	Het
Senp2	A	T	16: 22,041,380	H501L	possibly damaging	Het
Snx29	A	T	16: 11,738,363	I753F	probably damaging	Het
Tcf20	T	A	15: 82,856,185	H355L	probably damaging	Het
Tex2	T	C	11: 106,546,840	D668G	unknown	Het
Tlr12	G	A	4: 128,616,709	Q583*	probably null	Het
Tmem119	T	C	5: 113,795,228	I171V	probably damaging	Het
Ube2m	C	T	7: 13,036,322		probably null	Het
Vmn2r25	A	T	6: 123,840,103	I173N	probably damaging	Het
Whrn	A	T	4: 63,432,714	V15E	probably damaging	Het
Zfp558	A	C	9: 18,457,000	V164G	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGCCCCTTCAGGATCTAG -3'
(R):5'- TACTTCCACCTAGCGCCTAAG -3'

Sequencing Primer
(F):5'- TTCAGGATCTAGACCCGGCTC -3'
(R):5'- CACAGGTACAGAGAGCCCTG -3'

Posted On

2016-07-22