Incidental Mutation 'R5207:Cldn23'
ID402085
Institutional Source Beutler Lab
Gene Symbol Cldn23
Ensembl Gene ENSMUSG00000055976
Gene Nameclaudin 23
Synonyms
MMRRC Submission 042782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5207 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location35824712-35826559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35826028 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 102 (V102E)
Ref Sequence ENSEMBL: ENSMUSP00000049725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060128]
Predicted Effect probably damaging
Transcript: ENSMUST00000060128
AA Change: V102E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049725
Gene: ENSMUSG00000055976
AA Change: V102E

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 6e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210370
Meta Mutation Damage Score 0.3175 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and the protein encoded by this gene is 77% identical to the human homolog. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,793,594 probably benign Het
Alg6 C T 4: 99,719,194 L15F possibly damaging Het
Allc T A 12: 28,555,326 M325L probably benign Het
Ap3b2 T C 7: 81,476,769 N361S possibly damaging Het
Bmp8b A G 4: 123,115,921 probably benign Het
Borcs6 A T 11: 69,060,848 T351S probably damaging Het
Casc1 A T 6: 145,179,068 D510E probably damaging Het
Ccar1 T C 10: 62,753,281 R808G unknown Het
Celsr3 A T 9: 108,832,759 T1480S probably benign Het
Chdh C T 14: 30,031,361 P76S probably damaging Het
Chmp7 T C 14: 69,732,306 S62G probably benign Het
Csn2 G A 5: 87,694,962 Q69* probably null Het
Ctrc A C 4: 141,840,384 I136S probably damaging Het
Cysltr2 A C 14: 73,029,511 L253R probably damaging Het
Ddr2 G A 1: 169,984,961 T654M probably damaging Het
Derl2 G T 11: 71,019,247 probably null Het
Dock5 T C 14: 67,776,284 S1330G probably benign Het
Emp3 T C 7: 45,919,949 N56S probably benign Het
Fam161a A T 11: 23,020,583 K195* probably null Het
Fam71b T C 11: 46,405,163 S121P probably benign Het
Ficd T A 5: 113,737,011 V47E probably benign Het
Gbp10 T C 5: 105,224,709 T123A probably benign Het
Gdf7 C T 12: 8,298,371 A309T unknown Het
Gm14486 G T 2: 30,658,560 noncoding transcript Het
Herc1 T A 9: 66,399,869 C990* probably null Het
Itgb4 T C 11: 116,006,539 V1530A probably damaging Het
Itpka G A 2: 119,750,493 R374H probably damaging Het
Lacc1 T A 14: 77,034,154 probably null Het
Med23 A T 10: 24,895,836 K225* probably null Het
Mrgpra3 T A 7: 47,590,161 T6S probably benign Het
Mroh7 T A 4: 106,721,386 N32Y probably damaging Het
Mrps2 A G 2: 28,469,751 R207G probably damaging Het
Mup20 A C 4: 62,051,586 probably null Het
Nagpa A G 16: 5,199,614 probably null Het
Nek3 A T 8: 22,132,227 probably benign Het
Nes G A 3: 87,978,628 G1398E probably damaging Het
Nf1 G T 11: 79,454,189 V1323L probably damaging Het
Olfr1416 A T 1: 92,479,872 F250I probably benign Het
Olfr1446 T A 19: 12,890,437 I47F probably benign Het
Olfr791 T C 10: 129,526,904 F226L probably benign Het
Paqr8 G T 1: 20,935,258 C212F probably benign Het
Pcdhb1 T C 18: 37,266,462 Y489H probably damaging Het
Piwil2 T C 14: 70,392,517 K683E probably damaging Het
Pjvk A C 2: 76,650,390 probably null Het
Pkd1l3 A T 8: 109,633,191 S893C probably damaging Het
Plxna2 A G 1: 194,788,899 T993A probably benign Het
Ppp2r2b A T 18: 42,688,352 I247N probably damaging Het
Rac2 T C 15: 78,565,454 N92S probably damaging Het
Senp2 A T 16: 22,041,380 H501L possibly damaging Het
Snx29 A T 16: 11,738,363 I753F probably damaging Het
Tcf20 T A 15: 82,856,185 H355L probably damaging Het
Tex2 T C 11: 106,546,840 D668G unknown Het
Tlr12 G A 4: 128,616,709 Q583* probably null Het
Tmem119 T C 5: 113,795,228 I171V probably damaging Het
Ube2m C T 7: 13,036,322 probably null Het
Vmn2r25 A T 6: 123,840,103 I173N probably damaging Het
Whrn A T 4: 63,432,714 V15E probably damaging Het
Zfp558 A C 9: 18,457,000 V164G possibly damaging Het
Other mutations in Cldn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Cldn23 APN 8 35825920 missense possibly damaging 0.81
IGL01767:Cldn23 APN 8 35825662 missense probably damaging 1.00
IGL02078:Cldn23 APN 8 35826205 missense possibly damaging 0.94
IGL03346:Cldn23 APN 8 35825440 intron probably benign
R1610:Cldn23 UTSW 8 35825930 missense probably damaging 1.00
R1753:Cldn23 UTSW 8 35825986 missense possibly damaging 0.94
R1915:Cldn23 UTSW 8 35825945 missense possibly damaging 0.69
R2121:Cldn23 UTSW 8 35826235 missense probably benign
R4342:Cldn23 UTSW 8 35825498 missense probably benign 0.00
R5167:Cldn23 UTSW 8 35826320 missense possibly damaging 0.89
R6102:Cldn23 UTSW 8 35825551 missense probably benign 0.00
R7106:Cldn23 UTSW 8 35825915 missense probably benign
R7363:Cldn23 UTSW 8 35825505 critical splice donor site probably null
R7721:Cldn23 UTSW 8 35826263 missense possibly damaging 0.89
R8119:Cldn23 UTSW 8 35825902 missense probably damaging 0.99
Z1176:Cldn23 UTSW 8 35826277 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCTGTAGTACTTGATGGCAG -3'
(R):5'- TGAAGGGCTTTCTGGACCAG -3'

Sequencing Primer
(F):5'- TCCACGTAGACGGTGCTGATG -3'
(R):5'- AGCCAGTGGACGTGGTG -3'
Posted On2016-07-22