Incidental Mutation 'R5207:Med23'
ID402090
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 042782-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5207 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 24895836 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 225 (K225*)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect probably null
Transcript: ENSMUST00000020159
AA Change: K585*
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: K585*

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092646
AA Change: K591*
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: K591*

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably null
Transcript: ENSMUST00000176285
AA Change: K225*
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: K225*

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179967
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,793,594 probably benign Het
Alg6 C T 4: 99,719,194 L15F possibly damaging Het
Allc T A 12: 28,555,326 M325L probably benign Het
Ap3b2 T C 7: 81,476,769 N361S possibly damaging Het
Bmp8b A G 4: 123,115,921 probably benign Het
Borcs6 A T 11: 69,060,848 T351S probably damaging Het
Casc1 A T 6: 145,179,068 D510E probably damaging Het
Ccar1 T C 10: 62,753,281 R808G unknown Het
Celsr3 A T 9: 108,832,759 T1480S probably benign Het
Chdh C T 14: 30,031,361 P76S probably damaging Het
Chmp7 T C 14: 69,732,306 S62G probably benign Het
Cldn23 A T 8: 35,826,028 V102E probably damaging Het
Csn2 G A 5: 87,694,962 Q69* probably null Het
Ctrc A C 4: 141,840,384 I136S probably damaging Het
Cysltr2 A C 14: 73,029,511 L253R probably damaging Het
Ddr2 G A 1: 169,984,961 T654M probably damaging Het
Derl2 G T 11: 71,019,247 probably null Het
Dock5 T C 14: 67,776,284 S1330G probably benign Het
Emp3 T C 7: 45,919,949 N56S probably benign Het
Fam161a A T 11: 23,020,583 K195* probably null Het
Fam71b T C 11: 46,405,163 S121P probably benign Het
Ficd T A 5: 113,737,011 V47E probably benign Het
Gbp10 T C 5: 105,224,709 T123A probably benign Het
Gdf7 C T 12: 8,298,371 A309T unknown Het
Gm14486 G T 2: 30,658,560 noncoding transcript Het
Herc1 T A 9: 66,399,869 C990* probably null Het
Itgb4 T C 11: 116,006,539 V1530A probably damaging Het
Itpka G A 2: 119,750,493 R374H probably damaging Het
Lacc1 T A 14: 77,034,154 probably null Het
Mrgpra3 T A 7: 47,590,161 T6S probably benign Het
Mroh7 T A 4: 106,721,386 N32Y probably damaging Het
Mrps2 A G 2: 28,469,751 R207G probably damaging Het
Mup20 A C 4: 62,051,586 probably null Het
Nagpa A G 16: 5,199,614 probably null Het
Nek3 A T 8: 22,132,227 probably benign Het
Nes G A 3: 87,978,628 G1398E probably damaging Het
Nf1 G T 11: 79,454,189 V1323L probably damaging Het
Olfr1416 A T 1: 92,479,872 F250I probably benign Het
Olfr1446 T A 19: 12,890,437 I47F probably benign Het
Olfr791 T C 10: 129,526,904 F226L probably benign Het
Paqr8 G T 1: 20,935,258 C212F probably benign Het
Pcdhb1 T C 18: 37,266,462 Y489H probably damaging Het
Piwil2 T C 14: 70,392,517 K683E probably damaging Het
Pjvk A C 2: 76,650,390 probably null Het
Pkd1l3 A T 8: 109,633,191 S893C probably damaging Het
Plxna2 A G 1: 194,788,899 T993A probably benign Het
Ppp2r2b A T 18: 42,688,352 I247N probably damaging Het
Rac2 T C 15: 78,565,454 N92S probably damaging Het
Senp2 A T 16: 22,041,380 H501L possibly damaging Het
Snx29 A T 16: 11,738,363 I753F probably damaging Het
Tcf20 T A 15: 82,856,185 H355L probably damaging Het
Tex2 T C 11: 106,546,840 D668G unknown Het
Tlr12 G A 4: 128,616,709 Q583* probably null Het
Tmem119 T C 5: 113,795,228 I171V probably damaging Het
Ube2m C T 7: 13,036,322 probably null Het
Vmn2r25 A T 6: 123,840,103 I173N probably damaging Het
Whrn A T 4: 63,432,714 V15E probably damaging Het
Zfp558 A C 9: 18,457,000 V164G possibly damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTCTGAGAAGAACAACTGTG -3'
(R):5'- ACACTAAGGGAGGCCTGTTC -3'

Sequencing Primer
(F):5'- CAACTGTGTTCATAGACACGGGTTC -3'
(R):5'- GCCCTTTGACTCCCACAG -3'
Posted On2016-07-22