Incidental Mutation 'R5207:Gdf7'
ID 402099
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
MMRRC Submission 042782-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.793) question?
Stock # R5207 (G1)
Quality Score 185
Status Not validated
Chromosome 12
Chromosomal Location 8347918-8351954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8348371 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 309 (A309T)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: A317T
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: A317T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217967
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: A309T
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,621,159 (GRCm39) probably benign Het
Alg6 C T 4: 99,607,431 (GRCm39) L15F possibly damaging Het
Allc T A 12: 28,605,325 (GRCm39) M325L probably benign Het
Ap3b2 T C 7: 81,126,517 (GRCm39) N361S possibly damaging Het
Bmp8b A G 4: 123,009,714 (GRCm39) probably benign Het
Borcs6 A T 11: 68,951,674 (GRCm39) T351S probably damaging Het
Ccar1 T C 10: 62,589,060 (GRCm39) R808G unknown Het
Celsr3 A T 9: 108,709,958 (GRCm39) T1480S probably benign Het
Chdh C T 14: 29,753,318 (GRCm39) P76S probably damaging Het
Chmp7 T C 14: 69,969,755 (GRCm39) S62G probably benign Het
Cldn23 A T 8: 36,293,182 (GRCm39) V102E probably damaging Het
Csn2 G A 5: 87,842,821 (GRCm39) Q69* probably null Het
Ctrc A C 4: 141,567,695 (GRCm39) I136S probably damaging Het
Cysltr2 A C 14: 73,266,951 (GRCm39) L253R probably damaging Het
Ddr2 G A 1: 169,812,530 (GRCm39) T654M probably damaging Het
Derl2 G T 11: 70,910,073 (GRCm39) probably null Het
Dnai7 A T 6: 145,124,794 (GRCm39) D510E probably damaging Het
Dock5 T C 14: 68,013,733 (GRCm39) S1330G probably benign Het
Emp3 T C 7: 45,569,373 (GRCm39) N56S probably benign Het
Fam161a A T 11: 22,970,583 (GRCm39) K195* probably null Het
Ficd T A 5: 113,875,072 (GRCm39) V47E probably benign Het
Garin3 T C 11: 46,295,990 (GRCm39) S121P probably benign Het
Gbp10 T C 5: 105,372,575 (GRCm39) T123A probably benign Het
Gm14486 G T 2: 30,548,572 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,307,151 (GRCm39) C990* probably null Het
Itgb4 T C 11: 115,897,365 (GRCm39) V1530A probably damaging Het
Itpka G A 2: 119,580,974 (GRCm39) R374H probably damaging Het
Lacc1 T A 14: 77,271,594 (GRCm39) probably null Het
Med23 A T 10: 24,771,734 (GRCm39) K225* probably null Het
Mrgpra3 T A 7: 47,239,909 (GRCm39) T6S probably benign Het
Mroh7 T A 4: 106,578,583 (GRCm39) N32Y probably damaging Het
Mrps2 A G 2: 28,359,763 (GRCm39) R207G probably damaging Het
Mup20 A C 4: 61,969,823 (GRCm39) probably null Het
Nagpa A G 16: 5,017,478 (GRCm39) probably null Het
Nek3 A T 8: 22,622,243 (GRCm39) probably benign Het
Nes G A 3: 87,885,935 (GRCm39) G1398E probably damaging Het
Nf1 G T 11: 79,345,015 (GRCm39) V1323L probably damaging Het
Or5b96 T A 19: 12,867,801 (GRCm39) I47F probably benign Het
Or6b2 A T 1: 92,407,594 (GRCm39) F250I probably benign Het
Or6c2 T C 10: 129,362,773 (GRCm39) F226L probably benign Het
Paqr8 G T 1: 21,005,482 (GRCm39) C212F probably benign Het
Pcdhb1 T C 18: 37,399,515 (GRCm39) Y489H probably damaging Het
Piwil2 T C 14: 70,629,966 (GRCm39) K683E probably damaging Het
Pjvk A C 2: 76,480,734 (GRCm39) probably null Het
Pkd1l3 A T 8: 110,359,823 (GRCm39) S893C probably damaging Het
Plxna2 A G 1: 194,471,207 (GRCm39) T993A probably benign Het
Ppp2r2b A T 18: 42,821,417 (GRCm39) I247N probably damaging Het
Rac2 T C 15: 78,449,654 (GRCm39) N92S probably damaging Het
Senp2 A T 16: 21,860,130 (GRCm39) H501L possibly damaging Het
Snx29 A T 16: 11,556,227 (GRCm39) I753F probably damaging Het
Tcf20 T A 15: 82,740,386 (GRCm39) H355L probably damaging Het
Tex2 T C 11: 106,437,666 (GRCm39) D668G unknown Het
Tlr12 G A 4: 128,510,502 (GRCm39) Q583* probably null Het
Tmem119 T C 5: 113,933,289 (GRCm39) I171V probably damaging Het
Ube2m C T 7: 12,770,249 (GRCm39) probably null Het
Vmn2r25 A T 6: 123,817,062 (GRCm39) I173N probably damaging Het
Whrn A T 4: 63,350,951 (GRCm39) V15E probably damaging Het
Zfp558 A C 9: 18,368,296 (GRCm39) V164G possibly damaging Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8,351,666 (GRCm39) missense unknown
R0781:Gdf7 UTSW 12 8,351,555 (GRCm39) splice site probably benign
R1457:Gdf7 UTSW 12 8,348,073 (GRCm39) missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8,351,698 (GRCm39) missense unknown
R1643:Gdf7 UTSW 12 8,347,971 (GRCm39) missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8,351,729 (GRCm39) missense unknown
R2439:Gdf7 UTSW 12 8,348,050 (GRCm39) missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8,348,470 (GRCm39) missense unknown
R3894:Gdf7 UTSW 12 8,348,845 (GRCm39) missense unknown
R4854:Gdf7 UTSW 12 8,348,014 (GRCm39) missense probably damaging 0.99
R6199:Gdf7 UTSW 12 8,348,832 (GRCm39) missense unknown
R6583:Gdf7 UTSW 12 8,351,758 (GRCm39) missense unknown
R7687:Gdf7 UTSW 12 8,348,257 (GRCm39) nonsense probably null
R7745:Gdf7 UTSW 12 8,351,854 (GRCm39) missense unknown
R8705:Gdf7 UTSW 12 8,348,167 (GRCm39) missense probably damaging 0.96
R8845:Gdf7 UTSW 12 8,348,905 (GRCm39) missense unknown
R9100:Gdf7 UTSW 12 8,348,652 (GRCm39) missense unknown
Z1176:Gdf7 UTSW 12 8,348,578 (GRCm39) missense unknown
Z1176:Gdf7 UTSW 12 8,348,409 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTCCTTAAAGTCCACGTG -3'
(R):5'- GCTTCCTGTTCGACGTATCCAG -3'

Sequencing Primer
(F):5'- ACGTGCAGTGACTTGCGAC -3'
(R):5'- AAGCGTTCGACGTGACG -3'
Posted On 2016-07-22