Mutagenetix > Incidental Mutations

Incidental Mutation 'R0415:Prex1'

40210

Institutional Source

Beutler Lab

Gene Symbol

Prex1

Ensembl Gene

ENSMUSG00000039621

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1

Synonyms

P-REX1

MMRRC Submission

038617-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.288) question?

Stock #

R0415 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166566342-166713832 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 166586699 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]

Predicted Effect

probably benign
Transcript: ENSMUST00000036719

SMART Domains

Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621

Domain	Start	End	E-Value	Type
low complexity region	3	27	N/A	INTRINSIC
RhoGEF	48	234	3.16e-52	SMART
PH	267	389	1.02e-10	SMART
DEP	418	491	6.86e-27	SMART
DEP	519	592	3.06e-24	SMART
PDZ	628	701	4.55e-1	SMART
PDZ	712	783	5.66e-1	SMART
low complexity region	800	811	N/A	INTRINSIC
low complexity region	814	825	N/A	INTRINSIC
low complexity region	1109	1127	N/A	INTRINSIC
low complexity region	1545	1555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099080

SMART Domains

Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	5	64	3.8e-18	PFAM
PH	97	219	1.02e-10	SMART
DEP	248	321	6.86e-27	SMART
DEP	349	422	3.06e-24	SMART
PDZ	458	531	4.55e-1	SMART
PDZ	542	613	5.66e-1	SMART
low complexity region	630	641	N/A	INTRINSIC
low complexity region	644	655	N/A	INTRINSIC
low complexity region	939	957	N/A	INTRINSIC
low complexity region	1375	1385	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109246

SMART Domains

Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621

Domain	Start	End	E-Value	Type
low complexity region	357	367	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (99/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427G23Rik	A	T	5: 23,831,050		noncoding transcript	Het
Acox2	A	G	14: 8,243,835		probably benign	Het
Adgb	T	C	10: 10,431,067		probably null	Het
Adgra3	C	A	5: 49,961,757		probably benign	Het
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ahnak	A	G	19: 9,012,871		probably benign	Het
Anapc2	A	G	2: 25,278,325	T159A	probably damaging	Het
Arfgef3	A	G	10: 18,613,127		probably benign	Het
Atf7ip	C	T	6: 136,560,012	S81L	possibly damaging	Het
Cacna1i	A	G	15: 80,368,830		probably benign	Het
Camk1	A	T	6: 113,341,891	Y20*	probably null	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
Cd109	T	A	9: 78,712,615	S1380T	probably benign	Het
Cfap57	A	T	4: 118,569,431	L1107Q	possibly damaging	Het
Col6a4	C	T	9: 106,075,080	V540I	probably damaging	Het
Cst9	T	A	2: 148,838,442		probably benign	Het
Cul5	C	T	9: 53,667,070	V73I	probably benign	Het
Cxcl16	T	A	11: 70,458,748	K84*	probably null	Het
Cyp2c29	T	C	19: 39,329,095		probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dip2c	C	T	13: 9,568,289		probably benign	Het
Dis3	A	T	14: 99,087,456	I513N	probably damaging	Het
Dnajc16	A	T	4: 141,789,048	L3*	probably null	Het
Dopey1	T	A	9: 86,506,502	L480M	probably damaging	Het
Eml6	A	G	11: 29,749,392	V1787A	possibly damaging	Het
Etnk1	A	G	6: 143,180,774	N115S	probably damaging	Het
Fryl	T	C	5: 73,098,414	Y758C	probably damaging	Het
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Ggnbp2	A	C	11: 84,833,225		probably benign	Het
Gm7137	A	G	10: 77,788,173		probably benign	Het
Gstm2	T	A	3: 107,984,006	Q132L	probably benign	Het
Habp2	T	C	19: 56,317,717		probably benign	Het
Hectd2	T	C	19: 36,584,884		probably benign	Het
Htr6	A	G	4: 139,062,081	I291T	possibly damaging	Het
Ighg2c	T	C	12: 113,287,910	D199G	unknown	Het
Itih2	A	G	2: 10,105,615		probably benign	Het
Kcnab2	A	G	4: 152,395,136	F248S	probably benign	Het
Kcnc4	T	C	3: 107,445,433	K610E	probably damaging	Het
Kcnk16	T	A	14: 20,262,975		probably null	Het
Kndc1	C	T	7: 139,930,124	T1293I	probably damaging	Het
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Lrrc8d	T	C	5: 105,811,865	L47P	probably damaging	Het
Lyst	T	C	13: 13,711,610		probably benign	Het
Macrod2	G	A	2: 142,210,145		probably null	Het
Micalcl	C	T	7: 112,381,028	R70C	probably damaging	Het
Mllt3	ACTGCTGCTGCTGCTGCTGCT	ACTGCTGCTGCTGCTGCT	4: 87,841,339		probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nup205	T	C	6: 35,214,634		probably benign	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Olfr229	A	G	9: 39,909,983	Y60C	probably damaging	Het
Olfr78	C	T	7: 102,742,087	M305I	probably benign	Het
Olfr893	A	T	9: 38,209,973	M305L	probably benign	Het
Pard3	G	A	8: 127,610,566	G1221D	probably damaging	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Pcsk6	C	T	7: 66,033,874	R746C	probably damaging	Het
Pif1	G	A	9: 65,588,051	C81Y	probably benign	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plcd4	C	A	1: 74,552,097	S217Y	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Het
Polr2k	A	G	15: 36,175,456	Y45C	probably damaging	Het
Pqlc3	C	A	12: 16,997,710		probably benign	Het
Pth2r	A	G	1: 65,388,439	M424V	probably benign	Het
Pygm	A	G	19: 6,391,366	R464G	probably benign	Het
Rad51c	A	G	11: 87,397,655	L234P	probably damaging	Het
Rnf145	A	G	11: 44,525,138	Y60C	probably damaging	Het
Rnf167	T	C	11: 70,649,699	I135T	probably damaging	Het
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Het
Selenbp1	T	C	3: 94,936,913	V27A	possibly damaging	Het
Selenof	T	G	3: 144,577,692	L14R	probably damaging	Het
Sfswap	A	T	5: 129,504,126	D121V	probably damaging	Het
Slc25a34	C	A	4: 141,620,469	M300I	possibly damaging	Het
Slc34a3	T	G	2: 25,229,110	T583P	probably benign	Het
Smg1	C	A	7: 118,182,468	A1199S	probably benign	Het
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Sptbn1	A	C	11: 30,149,576	N229K	probably damaging	Het
Sult2b1	A	G	7: 45,730,092		probably benign	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem132c	A	G	5: 127,563,705	E980G	probably damaging	Het
Tmem247	G	T	17: 86,922,322	C197F	probably damaging	Het
Tmem251	T	A	12: 102,744,876	Y119*	probably null	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Het
Tmprss13	A	G	9: 45,337,132		probably null	Het
Trove2	G	T	1: 143,760,075	N444K	probably benign	Het
Ubr5	T	C	15: 37,972,980	T2626A	probably damaging	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Het
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Het
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Vmn2r74	A	C	7: 85,961,410	C25G	probably damaging	Het
Xndc1	T	C	7: 102,080,616		probably benign	Het
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Het
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Het
Zfp316	T	A	5: 143,264,491	T56S	unknown	Het
Zfp345	A	G	2: 150,474,559		probably benign	Het

Other mutations in Prex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Prex1	APN	2	166638401	missense	probably damaging	1.00
IGL00309:Prex1	APN	2	166609823	missense	probably damaging	0.99
IGL00953:Prex1	APN	2	166638409	missense	probably damaging	1.00
IGL00961:Prex1	APN	2	166585736	missense	probably damaging	0.98
IGL01300:Prex1	APN	2	166638407	missense	possibly damaging	0.46
IGL01318:Prex1	APN	2	166569340	splice site	probably benign
IGL01753:Prex1	APN	2	166602882	missense	probably benign	0.11
IGL01819:Prex1	APN	2	166621245	missense	probably damaging	1.00
IGL02058:Prex1	APN	2	166585183	missense	probably benign	0.00
IGL02251:Prex1	APN	2	166577886	missense	probably damaging	0.99
IGL02326:Prex1	APN	2	166621185	missense	probably benign	0.35
IGL02366:Prex1	APN	2	166580427	missense	probably damaging	1.00
IGL02414:Prex1	APN	2	166609828	missense	probably damaging	1.00
IGL02660:Prex1	APN	2	166593867	missense	probably damaging	0.97
IGL02666:Prex1	APN	2	166572989	missense	probably benign	0.00
IGL02874:Prex1	APN	2	166585047	missense	probably damaging	1.00
IGL02935:Prex1	APN	2	166570345	missense	probably damaging	1.00
IGL03179:Prex1	APN	2	166585194	missense	probably benign	0.31
R0207:Prex1	UTSW	2	166585898	missense	possibly damaging	0.92
R0420:Prex1	UTSW	2	166589571	missense	probably benign	0.13
R0449:Prex1	UTSW	2	166569377	missense	probably benign	0.16
R0458:Prex1	UTSW	2	166585823	missense	probably damaging	0.99
R0927:Prex1	UTSW	2	166586537	missense	probably benign	0.01
R1299:Prex1	UTSW	2	166585907	missense	possibly damaging	0.62
R1414:Prex1	UTSW	2	166593861	missense	probably damaging	1.00
R1440:Prex1	UTSW	2	166580463	missense	probably damaging	0.98
R1506:Prex1	UTSW	2	166587081	missense	probably damaging	1.00
R1725:Prex1	UTSW	2	166601736	missense	probably damaging	1.00
R1831:Prex1	UTSW	2	166585101	missense	probably damaging	1.00
R1883:Prex1	UTSW	2	166583272	missense	probably benign	0.20
R1896:Prex1	UTSW	2	166586654	missense	probably benign	0.01
R2022:Prex1	UTSW	2	166575614	missense	possibly damaging	0.80
R2091:Prex1	UTSW	2	166569365	missense	possibly damaging	0.95
R2258:Prex1	UTSW	2	166587157	missense	probably benign	0.00
R2263:Prex1	UTSW	2	166589068	splice site	probably benign
R2276:Prex1	UTSW	2	166577955	missense	probably benign	0.34
R2279:Prex1	UTSW	2	166577955	missense	probably benign	0.34
R2680:Prex1	UTSW	2	166601772	missense	possibly damaging	0.92
R3024:Prex1	UTSW	2	166589036	missense	probably benign	0.04
R3421:Prex1	UTSW	2	166617854	missense	probably damaging	1.00
R3614:Prex1	UTSW	2	166609781	missense	probably damaging	1.00
R4244:Prex1	UTSW	2	166570336	missense	probably damaging	1.00
R4605:Prex1	UTSW	2	166713544	missense	probably benign	0.45
R4685:Prex1	UTSW	2	166638332	missense	probably damaging	0.97
R4787:Prex1	UTSW	2	166638340	missense	probably benign	0.01
R4796:Prex1	UTSW	2	166592291	missense	probably damaging	1.00
R4825:Prex1	UTSW	2	166585857	nonsense	probably null
R4955:Prex1	UTSW	2	166573223	missense	probably damaging	0.99
R5046:Prex1	UTSW	2	166572963	missense	probably benign	0.00
R5095:Prex1	UTSW	2	166581921	missense	probably damaging	1.00
R5408:Prex1	UTSW	2	166575653	small insertion	probably benign
R5462:Prex1	UTSW	2	166644808	missense	probably benign	0.02
R5535:Prex1	UTSW	2	166580273	missense	possibly damaging	0.80
R5777:Prex1	UTSW	2	166586659	missense	probably damaging	1.00
R5813:Prex1	UTSW	2	166583207	missense	probably benign
R5860:Prex1	UTSW	2	166644684	intron	probably benign
R5984:Prex1	UTSW	2	166585744	missense	probably damaging	1.00
R6009:Prex1	UTSW	2	166581984	missense	probably damaging	1.00
R6174:Prex1	UTSW	2	166572963	missense	probably benign	0.00
R6345:Prex1	UTSW	2	166572960	missense	probably null	0.81
R6897:Prex1	UTSW	2	166581993	missense	probably damaging	0.99
R6935:Prex1	UTSW	2	166599655	missense	probably damaging	1.00
R7025:Prex1	UTSW	2	166613187	small insertion	probably benign
R7037:Prex1	UTSW	2	166587180	missense	probably benign	0.05
R7076:Prex1	UTSW	2	166633382	missense	probably damaging	0.99
R7181:Prex1	UTSW	2	166570371	missense	probably damaging	1.00
R7361:Prex1	UTSW	2	166713570	missense	probably benign	0.04
R7381:Prex1	UTSW	2	166587127	missense	probably damaging	1.00
R7721:Prex1	UTSW	2	166577890	nonsense	probably null
R7763:Prex1	UTSW	2	166713709	missense	unknown
R7809:Prex1	UTSW	2	166573244	missense	possibly damaging	0.91
R7915:Prex1	UTSW	2	166621192	missense	probably damaging	1.00
R7971:Prex1	UTSW	2	166581939	missense	probably damaging	1.00
R7998:Prex1	UTSW	2	166587045	critical splice donor site	probably null
R8029:Prex1	UTSW	2	166575603	missense	probably benign	0.01
R8193:Prex1	UTSW	2	166593860	missense	possibly damaging	0.60
R8352:Prex1	UTSW	2	166589573	missense	probably benign	0.05
R8452:Prex1	UTSW	2	166589573	missense	probably benign	0.05
X0065:Prex1	UTSW	2	166586625	missense	probably benign
Z1176:Prex1	UTSW	2	166572970	nonsense	probably null
Z1177:Prex1	UTSW	2	166592228	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCTGGATACCGCTGTACCTGAAG -3'
(R):5'- TGACCTGGTCTGTTCTGCCTCAAG -3'

Sequencing Primer
(F):5'- AGTACCTACCTCCTGGTAGCAG -3'
(R):5'- tccttaccccagtgctcatc -3'

Posted On

2013-05-23