Incidental Mutation 'R5207:Lacc1'
ID 402106
Institutional Source Beutler Lab
Gene Symbol Lacc1
Ensembl Gene ENSMUSG00000044350
Gene Name laccase domain containing 1
Synonyms 9030625A04Rik
MMRRC Submission 042782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5207 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 77261640-77274344 bp(-) (GRCm39)
Type of Mutation splice site (796 bp from exon)
DNA Base Change (assembly) T to A at 77271594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048208] [ENSMUST00000062789] [ENSMUST00000095625] [ENSMUST00000142300] [ENSMUST00000175810]
AlphaFold Q8BZT9
Predicted Effect probably benign
Transcript: ENSMUST00000048208
SMART Domains Protein: ENSMUSP00000036369
Gene: ENSMUSG00000034795

DomainStartEndE-ValueType
coiled coil region 33 102 N/A INTRINSIC
coiled coil region 152 182 N/A INTRINSIC
coiled coil region 209 279 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000062789
AA Change: T198S

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059173
Gene: ENSMUSG00000044350
AA Change: T198S

DomainStartEndE-ValueType
Pfam:Cu-oxidase_4 195 427 1.1e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095625
SMART Domains Protein: ENSMUSP00000093285
Gene: ENSMUSG00000034795

DomainStartEndE-ValueType
coiled coil region 68 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139809
Predicted Effect probably null
Transcript: ENSMUST00000142300
Predicted Effect probably benign
Transcript: ENSMUST00000175810
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fatty acid oxidation and glycolysis in macrophages and increased susceptibility to LPS-induced endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,621,159 (GRCm39) probably benign Het
Alg6 C T 4: 99,607,431 (GRCm39) L15F possibly damaging Het
Allc T A 12: 28,605,325 (GRCm39) M325L probably benign Het
Ap3b2 T C 7: 81,126,517 (GRCm39) N361S possibly damaging Het
Bmp8b A G 4: 123,009,714 (GRCm39) probably benign Het
Borcs6 A T 11: 68,951,674 (GRCm39) T351S probably damaging Het
Ccar1 T C 10: 62,589,060 (GRCm39) R808G unknown Het
Celsr3 A T 9: 108,709,958 (GRCm39) T1480S probably benign Het
Chdh C T 14: 29,753,318 (GRCm39) P76S probably damaging Het
Chmp7 T C 14: 69,969,755 (GRCm39) S62G probably benign Het
Cldn23 A T 8: 36,293,182 (GRCm39) V102E probably damaging Het
Csn2 G A 5: 87,842,821 (GRCm39) Q69* probably null Het
Ctrc A C 4: 141,567,695 (GRCm39) I136S probably damaging Het
Cysltr2 A C 14: 73,266,951 (GRCm39) L253R probably damaging Het
Ddr2 G A 1: 169,812,530 (GRCm39) T654M probably damaging Het
Derl2 G T 11: 70,910,073 (GRCm39) probably null Het
Dnai7 A T 6: 145,124,794 (GRCm39) D510E probably damaging Het
Dock5 T C 14: 68,013,733 (GRCm39) S1330G probably benign Het
Emp3 T C 7: 45,569,373 (GRCm39) N56S probably benign Het
Fam161a A T 11: 22,970,583 (GRCm39) K195* probably null Het
Ficd T A 5: 113,875,072 (GRCm39) V47E probably benign Het
Garin3 T C 11: 46,295,990 (GRCm39) S121P probably benign Het
Gbp10 T C 5: 105,372,575 (GRCm39) T123A probably benign Het
Gdf7 C T 12: 8,348,371 (GRCm39) A309T unknown Het
Gm14486 G T 2: 30,548,572 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,307,151 (GRCm39) C990* probably null Het
Itgb4 T C 11: 115,897,365 (GRCm39) V1530A probably damaging Het
Itpka G A 2: 119,580,974 (GRCm39) R374H probably damaging Het
Med23 A T 10: 24,771,734 (GRCm39) K225* probably null Het
Mrgpra3 T A 7: 47,239,909 (GRCm39) T6S probably benign Het
Mroh7 T A 4: 106,578,583 (GRCm39) N32Y probably damaging Het
Mrps2 A G 2: 28,359,763 (GRCm39) R207G probably damaging Het
Mup20 A C 4: 61,969,823 (GRCm39) probably null Het
Nagpa A G 16: 5,017,478 (GRCm39) probably null Het
Nek3 A T 8: 22,622,243 (GRCm39) probably benign Het
Nes G A 3: 87,885,935 (GRCm39) G1398E probably damaging Het
Nf1 G T 11: 79,345,015 (GRCm39) V1323L probably damaging Het
Or5b96 T A 19: 12,867,801 (GRCm39) I47F probably benign Het
Or6b2 A T 1: 92,407,594 (GRCm39) F250I probably benign Het
Or6c2 T C 10: 129,362,773 (GRCm39) F226L probably benign Het
Paqr8 G T 1: 21,005,482 (GRCm39) C212F probably benign Het
Pcdhb1 T C 18: 37,399,515 (GRCm39) Y489H probably damaging Het
Piwil2 T C 14: 70,629,966 (GRCm39) K683E probably damaging Het
Pjvk A C 2: 76,480,734 (GRCm39) probably null Het
Pkd1l3 A T 8: 110,359,823 (GRCm39) S893C probably damaging Het
Plxna2 A G 1: 194,471,207 (GRCm39) T993A probably benign Het
Ppp2r2b A T 18: 42,821,417 (GRCm39) I247N probably damaging Het
Rac2 T C 15: 78,449,654 (GRCm39) N92S probably damaging Het
Senp2 A T 16: 21,860,130 (GRCm39) H501L possibly damaging Het
Snx29 A T 16: 11,556,227 (GRCm39) I753F probably damaging Het
Tcf20 T A 15: 82,740,386 (GRCm39) H355L probably damaging Het
Tex2 T C 11: 106,437,666 (GRCm39) D668G unknown Het
Tlr12 G A 4: 128,510,502 (GRCm39) Q583* probably null Het
Tmem119 T C 5: 113,933,289 (GRCm39) I171V probably damaging Het
Ube2m C T 7: 12,770,249 (GRCm39) probably null Het
Vmn2r25 A T 6: 123,817,062 (GRCm39) I173N probably damaging Het
Whrn A T 4: 63,350,951 (GRCm39) V15E probably damaging Het
Zfp558 A C 9: 18,368,296 (GRCm39) V164G possibly damaging Het
Other mutations in Lacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Lacc1 APN 14 77,270,727 (GRCm39) missense probably benign 0.01
IGL02377:Lacc1 APN 14 77,267,055 (GRCm39) missense probably damaging 0.98
IGL03054:Lacc1 UTSW 14 77,268,355 (GRCm39) missense possibly damaging 0.94
PIT4280001:Lacc1 UTSW 14 77,272,517 (GRCm39) missense probably damaging 1.00
R0142:Lacc1 UTSW 14 77,268,239 (GRCm39) missense probably benign 0.25
R0352:Lacc1 UTSW 14 77,272,629 (GRCm39) missense probably damaging 0.98
R0606:Lacc1 UTSW 14 77,267,061 (GRCm39) missense probably damaging 1.00
R0865:Lacc1 UTSW 14 77,271,584 (GRCm39) missense possibly damaging 0.90
R1606:Lacc1 UTSW 14 77,267,081 (GRCm39) missense probably benign 0.01
R3419:Lacc1 UTSW 14 77,272,321 (GRCm39) missense probably benign 0.05
R3615:Lacc1 UTSW 14 77,270,727 (GRCm39) missense probably benign 0.01
R3616:Lacc1 UTSW 14 77,270,727 (GRCm39) missense probably benign 0.01
R4497:Lacc1 UTSW 14 77,271,470 (GRCm39) missense probably damaging 0.98
R5902:Lacc1 UTSW 14 77,272,239 (GRCm39) missense possibly damaging 0.95
R5974:Lacc1 UTSW 14 77,272,517 (GRCm39) missense probably damaging 1.00
R7084:Lacc1 UTSW 14 77,267,096 (GRCm39) missense probably benign 0.25
R7284:Lacc1 UTSW 14 77,268,309 (GRCm39) missense probably damaging 1.00
R8079:Lacc1 UTSW 14 77,266,992 (GRCm39) missense probably damaging 1.00
R8435:Lacc1 UTSW 14 77,272,475 (GRCm39) missense possibly damaging 0.96
R8951:Lacc1 UTSW 14 77,272,613 (GRCm39) missense probably benign 0.01
R9225:Lacc1 UTSW 14 77,272,414 (GRCm39) nonsense probably null
R9467:Lacc1 UTSW 14 77,267,024 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAAATGTTAGACGAAGCACC -3'
(R):5'- GTGACATCACACGGAGGTAC -3'

Sequencing Primer
(F):5'- TGTTAGACGAAGCACCAGAAAC -3'
(R):5'- CATCACACGGAGGTACAAAGAGC -3'
Posted On 2016-07-22