Incidental Mutation 'R5207:Tcf20'
ID 402109
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission 042782-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock # R5207 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 82808436-82987872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82856185 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 355 (H355L)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: H355L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: H355L

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: H355L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: H355L

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,793,594 probably benign Het
Alg6 C T 4: 99,719,194 L15F possibly damaging Het
Allc T A 12: 28,555,326 M325L probably benign Het
Ap3b2 T C 7: 81,476,769 N361S possibly damaging Het
Bmp8b A G 4: 123,115,921 probably benign Het
Borcs6 A T 11: 69,060,848 T351S probably damaging Het
Casc1 A T 6: 145,179,068 D510E probably damaging Het
Ccar1 T C 10: 62,753,281 R808G unknown Het
Celsr3 A T 9: 108,832,759 T1480S probably benign Het
Chdh C T 14: 30,031,361 P76S probably damaging Het
Chmp7 T C 14: 69,732,306 S62G probably benign Het
Cldn23 A T 8: 35,826,028 V102E probably damaging Het
Csn2 G A 5: 87,694,962 Q69* probably null Het
Ctrc A C 4: 141,840,384 I136S probably damaging Het
Cysltr2 A C 14: 73,029,511 L253R probably damaging Het
Ddr2 G A 1: 169,984,961 T654M probably damaging Het
Derl2 G T 11: 71,019,247 probably null Het
Dock5 T C 14: 67,776,284 S1330G probably benign Het
Emp3 T C 7: 45,919,949 N56S probably benign Het
Fam161a A T 11: 23,020,583 K195* probably null Het
Fam71b T C 11: 46,405,163 S121P probably benign Het
Ficd T A 5: 113,737,011 V47E probably benign Het
Gbp10 T C 5: 105,224,709 T123A probably benign Het
Gdf7 C T 12: 8,298,371 A309T unknown Het
Gm14486 G T 2: 30,658,560 noncoding transcript Het
Herc1 T A 9: 66,399,869 C990* probably null Het
Itgb4 T C 11: 116,006,539 V1530A probably damaging Het
Itpka G A 2: 119,750,493 R374H probably damaging Het
Lacc1 T A 14: 77,034,154 probably null Het
Med23 A T 10: 24,895,836 K225* probably null Het
Mrgpra3 T A 7: 47,590,161 T6S probably benign Het
Mroh7 T A 4: 106,721,386 N32Y probably damaging Het
Mrps2 A G 2: 28,469,751 R207G probably damaging Het
Mup20 A C 4: 62,051,586 probably null Het
Nagpa A G 16: 5,199,614 probably null Het
Nek3 A T 8: 22,132,227 probably benign Het
Nes G A 3: 87,978,628 G1398E probably damaging Het
Nf1 G T 11: 79,454,189 V1323L probably damaging Het
Olfr1416 A T 1: 92,479,872 F250I probably benign Het
Olfr1446 T A 19: 12,890,437 I47F probably benign Het
Olfr791 T C 10: 129,526,904 F226L probably benign Het
Paqr8 G T 1: 20,935,258 C212F probably benign Het
Pcdhb1 T C 18: 37,266,462 Y489H probably damaging Het
Piwil2 T C 14: 70,392,517 K683E probably damaging Het
Pjvk A C 2: 76,650,390 probably null Het
Pkd1l3 A T 8: 109,633,191 S893C probably damaging Het
Plxna2 A G 1: 194,788,899 T993A probably benign Het
Ppp2r2b A T 18: 42,688,352 I247N probably damaging Het
Rac2 T C 15: 78,565,454 N92S probably damaging Het
Senp2 A T 16: 22,041,380 H501L possibly damaging Het
Snx29 A T 16: 11,738,363 I753F probably damaging Het
Tex2 T C 11: 106,546,840 D668G unknown Het
Tlr12 G A 4: 128,616,709 Q583* probably null Het
Tmem119 T C 5: 113,795,228 I171V probably damaging Het
Ube2m C T 7: 13,036,322 probably null Het
Vmn2r25 A T 6: 123,840,103 I173N probably damaging Het
Whrn A T 4: 63,432,714 V15E probably damaging Het
Zfp558 A C 9: 18,457,000 V164G possibly damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9268:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9294:Tcf20 UTSW 15 82852696 missense probably benign 0.11
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGATTCTCACCACTCTGC -3'
(R):5'- TAATGCACAGGCTTATGGAACAC -3'

Sequencing Primer
(F):5'- GGAGATTCTCACCACTCTGCATGAG -3'
(R):5'- GCAAAGATTCCACCAGG -3'
Posted On 2016-07-22