Incidental Mutation 'R5207:Olfr1446'
ID402115
Institutional Source Beutler Lab
Gene Symbol Olfr1446
Ensembl Gene ENSMUSG00000057817
Gene Nameolfactory receptor 1446
SynonymsGA_x6K02T2RE5P-3220047-3219130, MOR202-2
MMRRC Submission 042782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5207 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12888266-12893524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12890437 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000149198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081236] [ENSMUST00000207741] [ENSMUST00000216805]
Predicted Effect probably benign
Transcript: ENSMUST00000081236
AA Change: I47F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079994
Gene: ENSMUSG00000057817
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 5.1e-6 PFAM
Pfam:7tm_1 42 291 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207319
AA Change: I47F
Predicted Effect probably benign
Transcript: ENSMUST00000207741
AA Change: I47F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216805
AA Change: I47F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.3998 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,793,594 probably benign Het
Alg6 C T 4: 99,719,194 L15F possibly damaging Het
Allc T A 12: 28,555,326 M325L probably benign Het
Ap3b2 T C 7: 81,476,769 N361S possibly damaging Het
Bmp8b A G 4: 123,115,921 probably benign Het
Borcs6 A T 11: 69,060,848 T351S probably damaging Het
Casc1 A T 6: 145,179,068 D510E probably damaging Het
Ccar1 T C 10: 62,753,281 R808G unknown Het
Celsr3 A T 9: 108,832,759 T1480S probably benign Het
Chdh C T 14: 30,031,361 P76S probably damaging Het
Chmp7 T C 14: 69,732,306 S62G probably benign Het
Cldn23 A T 8: 35,826,028 V102E probably damaging Het
Csn2 G A 5: 87,694,962 Q69* probably null Het
Ctrc A C 4: 141,840,384 I136S probably damaging Het
Cysltr2 A C 14: 73,029,511 L253R probably damaging Het
Ddr2 G A 1: 169,984,961 T654M probably damaging Het
Derl2 G T 11: 71,019,247 probably null Het
Dock5 T C 14: 67,776,284 S1330G probably benign Het
Emp3 T C 7: 45,919,949 N56S probably benign Het
Fam161a A T 11: 23,020,583 K195* probably null Het
Fam71b T C 11: 46,405,163 S121P probably benign Het
Ficd T A 5: 113,737,011 V47E probably benign Het
Gbp10 T C 5: 105,224,709 T123A probably benign Het
Gdf7 C T 12: 8,298,371 A309T unknown Het
Gm14486 G T 2: 30,658,560 noncoding transcript Het
Herc1 T A 9: 66,399,869 C990* probably null Het
Itgb4 T C 11: 116,006,539 V1530A probably damaging Het
Itpka G A 2: 119,750,493 R374H probably damaging Het
Lacc1 T A 14: 77,034,154 probably null Het
Med23 A T 10: 24,895,836 K225* probably null Het
Mrgpra3 T A 7: 47,590,161 T6S probably benign Het
Mroh7 T A 4: 106,721,386 N32Y probably damaging Het
Mrps2 A G 2: 28,469,751 R207G probably damaging Het
Mup20 A C 4: 62,051,586 probably null Het
Nagpa A G 16: 5,199,614 probably null Het
Nek3 A T 8: 22,132,227 probably benign Het
Nes G A 3: 87,978,628 G1398E probably damaging Het
Nf1 G T 11: 79,454,189 V1323L probably damaging Het
Olfr1416 A T 1: 92,479,872 F250I probably benign Het
Olfr791 T C 10: 129,526,904 F226L probably benign Het
Paqr8 G T 1: 20,935,258 C212F probably benign Het
Pcdhb1 T C 18: 37,266,462 Y489H probably damaging Het
Piwil2 T C 14: 70,392,517 K683E probably damaging Het
Pjvk A C 2: 76,650,390 probably null Het
Pkd1l3 A T 8: 109,633,191 S893C probably damaging Het
Plxna2 A G 1: 194,788,899 T993A probably benign Het
Ppp2r2b A T 18: 42,688,352 I247N probably damaging Het
Rac2 T C 15: 78,565,454 N92S probably damaging Het
Senp2 A T 16: 22,041,380 H501L possibly damaging Het
Snx29 A T 16: 11,738,363 I753F probably damaging Het
Tcf20 T A 15: 82,856,185 H355L probably damaging Het
Tex2 T C 11: 106,546,840 D668G unknown Het
Tlr12 G A 4: 128,616,709 Q583* probably null Het
Tmem119 T C 5: 113,795,228 I171V probably damaging Het
Ube2m C T 7: 13,036,322 probably null Het
Vmn2r25 A T 6: 123,840,103 I173N probably damaging Het
Whrn A T 4: 63,432,714 V15E probably damaging Het
Zfp558 A C 9: 18,457,000 V164G possibly damaging Het
Other mutations in Olfr1446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Olfr1446 APN 19 12889918 missense probably benign 0.00
IGL01399:Olfr1446 APN 19 12890439 missense probably benign 0.28
IGL01697:Olfr1446 APN 19 12890467 missense probably benign 0.24
IGL01739:Olfr1446 APN 19 12890149 missense probably benign 0.02
IGL01894:Olfr1446 APN 19 12889643 utr 3 prime probably benign
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R1163:Olfr1446 UTSW 19 12890149 missense probably benign 0.02
R1769:Olfr1446 UTSW 19 12889683 missense probably damaging 1.00
R4406:Olfr1446 UTSW 19 12890234 nonsense probably null
R5038:Olfr1446 UTSW 19 12890406 missense probably damaging 1.00
R5627:Olfr1446 UTSW 19 12890299 missense probably damaging 1.00
R5995:Olfr1446 UTSW 19 12890597 splice site probably null
R8043:Olfr1446 UTSW 19 12889731 missense probably damaging 1.00
R8254:Olfr1446 UTSW 19 12890485 missense probably benign 0.00
X0062:Olfr1446 UTSW 19 12890563 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACATCTGAGCAGCACAGTC -3'
(R):5'- CCCGCATTATCTTCTGGAATGTAC -3'

Sequencing Primer
(F):5'- CATCTGAGCAGCACAGTCATTGTAG -3'
(R):5'- CTGGAATGTACAAATACTAGTTGGC -3'
Posted On2016-07-22