Incidental Mutation 'R5208:Disp2'
ID402133
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Namedispatched RND tramsporter family member 2
SynonymsB230210L08Rik, DispB
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118779719-118811293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118791805 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1006 (R1006L)
Ref Sequence ENSEMBL: ENSMUSP00000037136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
Predicted Effect probably damaging
Transcript: ENSMUST00000037547
AA Change: R1006L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: R1006L

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118786278 missense probably damaging 1.00
IGL00970:Disp2 APN 2 118791793 missense probably damaging 1.00
IGL01790:Disp2 APN 2 118790880 missense probably damaging 1.00
IGL01809:Disp2 APN 2 118787264 splice site probably benign
IGL02069:Disp2 APN 2 118790680 missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118790869 missense probably benign
IGL02143:Disp2 APN 2 118789969 missense probably damaging 1.00
IGL02155:Disp2 APN 2 118791804 missense probably damaging 1.00
IGL02884:Disp2 APN 2 118787551 splice site probably benign
IGL03113:Disp2 APN 2 118790778 unclassified probably null
IGL03194:Disp2 APN 2 118787629 missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118787644 missense probably benign 0.01
R0109:Disp2 UTSW 2 118791816 missense probably damaging 1.00
R0126:Disp2 UTSW 2 118790338 missense probably damaging 1.00
R0603:Disp2 UTSW 2 118792006 missense probably damaging 1.00
R0610:Disp2 UTSW 2 118792236 missense probably benign 0.02
R0639:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118789762 missense probably benign 0.00
R0781:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1110:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1243:Disp2 UTSW 2 118791822 missense probably damaging 1.00
R1587:Disp2 UTSW 2 118791583 missense probably damaging 1.00
R1739:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R1771:Disp2 UTSW 2 118791297 nonsense probably null
R1781:Disp2 UTSW 2 118792561 missense probably damaging 0.96
R1918:Disp2 UTSW 2 118791927 missense probably benign
R1956:Disp2 UTSW 2 118792223 missense probably benign 0.02
R2167:Disp2 UTSW 2 118791685 missense probably damaging 1.00
R2206:Disp2 UTSW 2 118792244 missense probably benign 0.02
R4031:Disp2 UTSW 2 118791880 missense probably benign 0.27
R4617:Disp2 UTSW 2 118790162 missense probably benign
R4656:Disp2 UTSW 2 118790563 missense probably damaging 1.00
R4684:Disp2 UTSW 2 118792756 missense probably damaging 1.00
R4696:Disp2 UTSW 2 118791684 nonsense probably null
R4697:Disp2 UTSW 2 118791684 nonsense probably null
R4738:Disp2 UTSW 2 118790326 missense probably damaging 0.97
R4834:Disp2 UTSW 2 118792504 missense probably benign 0.09
R4914:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4915:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4918:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R5045:Disp2 UTSW 2 118792062 missense probably benign 0.03
R5303:Disp2 UTSW 2 118810848 unclassified probably benign
R5350:Disp2 UTSW 2 118787575 missense probably benign 0.23
R5355:Disp2 UTSW 2 118786911 missense probably benign 0.00
R6011:Disp2 UTSW 2 118790820 missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6139:Disp2 UTSW 2 118790662 missense probably damaging 0.97
R6169:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R6187:Disp2 UTSW 2 118792143 missense probably damaging 1.00
R6209:Disp2 UTSW 2 118786921 missense probably damaging 1.00
R6250:Disp2 UTSW 2 118790766 missense probably damaging 1.00
R6392:Disp2 UTSW 2 118790749 missense probably damaging 1.00
R7138:Disp2 UTSW 2 118786880 missense probably benign
R7156:Disp2 UTSW 2 118791811 missense probably damaging 1.00
R7230:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R7400:Disp2 UTSW 2 118791886 missense probably damaging 1.00
R7460:Disp2 UTSW 2 118789780 missense probably damaging 1.00
R7505:Disp2 UTSW 2 118791088 missense probably damaging 1.00
R7542:Disp2 UTSW 2 118791118 missense probably damaging 0.97
R7728:Disp2 UTSW 2 118791480 missense probably benign 0.31
R7757:Disp2 UTSW 2 118790910 missense probably damaging 1.00
R7798:Disp2 UTSW 2 118791879 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTCTGTTCTCTGTGGCAG -3'
(R):5'- TGGCCACAGTTCTTTTCTGG -3'

Sequencing Primer
(F):5'- CTCTGTGGCAGCTGTGG -3'
(R):5'- GTTCTTTTCTGGCCCGAAGAAACAG -3'
Posted On2016-07-22