Incidental Mutation 'R5208:Tars2'
ID402140
Institutional Source Beutler Lab
Gene Symbol Tars2
Ensembl Gene ENSMUSG00000028107
Gene Namethreonyl-tRNA synthetase 2, mitochondrial (putative)
SynonymsTarsl1, 2610024N01Rik
MMRRC Submission 042783-MU
Accession Numbers

Genbank: NM_027931.3, NM_001163617.1, NM_001163618.1, NM_001163619.1; Ensembl: ENSMUST00000029752, ENSMUST00000074339 , ENSMUST00000098857, ENSMUST00000163530

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95739976-95760206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95747593 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 128 (W128R)
Ref Sequence ENSEMBL: ENSMUSP00000143271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000196868] [ENSMUST00000197720] [ENSMUST00000198289] [ENSMUST00000199570] [ENSMUST00000199464]
Predicted Effect probably damaging
Transcript: ENSMUST00000029752
AA Change: W367R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: W367R

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074339
AA Change: W367R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: W367R

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098857
SMART Domains Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 6.7e-16 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
SCOP:d1atia2 332 417 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163530
AA Change: W286R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: W286R

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195929
AA Change: W79R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107
AA Change: W79R

DomainStartEndE-ValueType
Pfam:tRNA_SAD 1 28 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196475
Predicted Effect probably benign
Transcript: ENSMUST00000196868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197389
Predicted Effect probably benign
Transcript: ENSMUST00000197720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198194
Predicted Effect probably damaging
Transcript: ENSMUST00000198289
AA Change: W128R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107
AA Change: W128R

DomainStartEndE-ValueType
tRNA_SAD 2 43 2.6e-8 SMART
Pfam:tRNA-synt_2b 97 142 6.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect probably benign
Transcript: ENSMUST00000199570
SMART Domains Protein: ENSMUSP00000143038
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.5e-13 PFAM
tRNA_SAD 152 201 8.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Tars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Tars2 APN 3 95740278 missense probably damaging 1.00
IGL02523:Tars2 APN 3 95741393 missense probably damaging 1.00
IGL02709:Tars2 APN 3 95742071 splice site probably benign
IGL03286:Tars2 APN 3 95754755 splice site probably benign
IGL03348:Tars2 APN 3 95740268 splice site probably null
B6584:Tars2 UTSW 3 95742150 splice site probably null
R0548:Tars2 UTSW 3 95742659 missense probably damaging 1.00
R0657:Tars2 UTSW 3 95748557 missense probably benign 0.00
R1955:Tars2 UTSW 3 95747454 missense probably damaging 1.00
R2070:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R2071:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R3025:Tars2 UTSW 3 95747640 missense possibly damaging 0.71
R3962:Tars2 UTSW 3 95754756 critical splice donor site probably null
R4676:Tars2 UTSW 3 95753091 missense probably damaging 1.00
R4775:Tars2 UTSW 3 95746647 missense probably damaging 1.00
R5512:Tars2 UTSW 3 95750416 missense probably damaging 1.00
R5894:Tars2 UTSW 3 95747652 splice site probably null
R5965:Tars2 UTSW 3 95748152 splice site probably null
R6381:Tars2 UTSW 3 95754487 nonsense probably null
R6953:Tars2 UTSW 3 95753114 missense possibly damaging 0.63
R7042:Tars2 UTSW 3 95750745 missense probably benign 0.00
R7648:Tars2 UTSW 3 95750982 missense probably benign 0.26
R7877:Tars2 UTSW 3 95746089 missense probably damaging 0.99
R7946:Tars2 UTSW 3 95750381 missense probably damaging 0.99
R8021:Tars2 UTSW 3 95747514 missense probably benign
R8260:Tars2 UTSW 3 95754820 missense probably damaging 0.99
R8310:Tars2 UTSW 3 95750959 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTTTACATTTGGTGACCGTATCC -3'
(R):5'- CTAGGGAGTTGGTCAGCATG -3'

Sequencing Primer
(F):5'- ATTTGGTGACCGTATCCCAGCC -3'
(R):5'- GTTGGTCAGCATGGTATTTAAAAGC -3'
Posted On2016-07-22