Mutagenetix > Incidental Mutations

Incidental Mutation 'R5208:Inpp5b'

402143

Institutional Source

Beutler Lab

Gene Symbol

Inpp5b

Ensembl Gene

ENSMUSG00000028894

Gene Name

inositol polyphosphate-5-phosphatase B

Synonyms

75kDa

MMRRC Submission

042783-MU

Accession Numbers

Ncbi RefSeq: NM_008385.3; MGI:103257

Is this an essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R5208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124741850-124801511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124751317 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 179 (D179N)

Ref Sequence

ENSEMBL: ENSMUSP00000115176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094782] [ENSMUST00000153837] [ENSMUST00000154229] [ENSMUST00000184454]

Predicted Effect

probably benign
Transcript: ENSMUST00000094782
AA Change: D133N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000092375
Gene: ENSMUSG00000028894
AA Change: D133N

Domain	Start	End	E-Value	Type
Pfam:INPP5B_PH	1	150	4.3e-61	PFAM
low complexity region	206	220	N/A	INTRINSIC
IPPc	343	644	6.29e-126	SMART
Blast:RhoGAP	706	732	1e-7	BLAST
Blast:RhoGAP	755	809	2e-24	BLAST
RhoGAP	827	993	6.77e-37	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131381

Predicted Effect

probably benign
Transcript: ENSMUST00000153837
AA Change: D133N

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000122568
Gene: ENSMUSG00000028894
AA Change: D133N

Domain	Start	End	E-Value	Type
PDB:2KIG\|A	1	156	1e-113	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154229
AA Change: D179N

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115176
Gene: ENSMUSG00000028894
AA Change: D179N

Domain	Start	End	E-Value	Type
PDB:2KIG\|A	1	202	1e-104	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000184454
AA Change: D133N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000139221
Gene: ENSMUSG00000028894
AA Change: D133N

Domain	Start	End	E-Value	Type
PDB:2KIG\|A	1	156	1e-105	PDB
low complexity region	206	220	N/A	INTRINSIC
IPPc	343	644	6.29e-126	SMART
PDB:3QBT\|H	645	782	6e-49	PDB

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

Strain: 2159609;2159620
FUNCTION: This gene encodes a member of the inositol polyphosphate-5-phosphatase (INPP5) family. This protein hydrolyzes the 5' phosphate from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol-1,4,5-trisphosphate, which results in changes to multiple signaling pathways. This protein may be involved in protein trafficking and secretion. Homozygous knockout mice exhibit impaired spermatogenesis and male sterility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null male mice are infertile with a disruption in spermatogenesis and a defect in adherens junctions processing. [provided by MGI curators]

Allele List at MGI

All alleles(24) : Targeted(6) Gene trapped(18)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	C	A	7: 140,298,036	A977D	probably benign	Het
Aadacl4	A	T	4: 144,617,828	N58I	probably benign	Het
Adgra3	T	C	5: 50,011,515	D163G	probably damaging	Het
Alcam	C	A	16: 52,295,048	E236*	probably null	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Aplf	G	T	6: 87,642,026		probably null	Het
Arl4a	A	T	12: 40,036,745	M1K	probably null	Het
Asic4	A	G	1: 75,451,226	D132G	probably damaging	Het
Bbs12	T	C	3: 37,320,273	I290T	probably benign	Het
BC024139	A	G	15: 76,124,665	S290P	probably benign	Het
Bmp6	G	A	13: 38,469,697	A247T	probably benign	Het
Cadps	A	G	14: 12,457,711	S1057P	possibly damaging	Het
Caprin1	A	C	2: 103,769,433		probably null	Het
Cdc42bpg	G	A	19: 6,321,720	R1343K	probably benign	Het
Cdk18	A	T	1: 132,117,480		probably null	Het
Cenpf	A	T	1: 189,671,046		probably null	Het
Cfhr1	A	T	1: 139,556,330		probably null	Het
Chn2	A	T	6: 54,295,801	I201F	probably damaging	Het
Chrdl2	A	G	7: 100,023,922	D175G	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah3	C	G	7: 120,032,638	D1365H	probably damaging	Het
Efcab8	T	A	2: 153,802,423	Y372*	probably null	Het
Eftud2	G	A	11: 102,841,185	P768S	probably damaging	Het
Ehmt1	A	C	2: 24,801,533	S1170A	probably benign	Het
Gdpd4	A	C	7: 98,014,911	K572Q	probably benign	Het
Gm7356	T	C	17: 14,001,194	E191G	probably damaging	Het
Gm8674	A	T	13: 49,901,921		noncoding transcript	Het
Gulp1	T	G	1: 44,781,039	H235Q	probably benign	Het
Hormad1	T	C	3: 95,578,107	V202A	possibly damaging	Het
Kcnk4	T	A	19: 6,927,701	Y194F	possibly damaging	Het
Lars	A	C	18: 42,217,557	S896A	probably benign	Het
Lonp1	A	G	17: 56,617,793	V538A	probably damaging	Het
Map3k14	A	T	11: 103,239,146	L315Q	probably damaging	Het
Met	T	A	6: 17,526,423	Y500*	probably null	Het
Mga	T	G	2: 119,947,981	I2093M	possibly damaging	Het
Mpl	T	G	4: 118,455,881	I152L	probably benign	Het
Mthfsd	G	A	8: 121,108,319		probably benign	Het
Mup4	A	G	4: 59,958,119	F150L	probably damaging	Het
Mybph	T	A	1: 134,193,535	V11D	probably benign	Het
Olfr1278	A	T	2: 111,292,601	E111V	probably damaging	Het
Olfr668	A	G	7: 104,925,726	F13L	probably benign	Het
Olfr988	T	A	2: 85,353,798	I43F	probably benign	Het
Pde4a	T	C	9: 21,203,558		probably null	Het
Pex2	C	T	3: 5,561,368	R127H	probably benign	Het
Pgap3	A	G	11: 98,398,048	W94R	probably damaging	Het
Prl4a1	T	C	13: 28,018,484	V14A	probably benign	Het
Psg25	A	T	7: 18,526,535	I146N	probably benign	Het
Ptprn2	A	G	12: 116,858,928	Y209C	probably damaging	Het
Sema4c	T	A	1: 36,550,326	D573V	probably damaging	Het
Setx	A	T	2: 29,166,367	I2192F	possibly damaging	Het
Sp4	A	G	12: 118,299,546	L255P	probably damaging	Het
Spaca7	A	G	8: 12,586,456	Y94C	probably damaging	Het
Stt3a	T	G	9: 36,746,595	I390L	possibly damaging	Het
Tars2	A	G	3: 95,747,593	W128R	probably damaging	Het
Tll1	G	A	8: 64,051,493	T623M	probably damaging	Het
Tmem129	A	T	5: 33,655,506	V166E	probably damaging	Het
Tmem200a	T	A	10: 25,994,153	I73F	probably benign	Het
Tnks1bp1	T	C	2: 85,070,632	M1561T	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Zfat	A	T	15: 68,180,721	I401N	probably damaging	Het
Zfp142	A	T	1: 74,570,868	V1153E	probably benign	Het
Zwilch	T	C	9: 64,152,923	I354V	probably benign	Het

Other mutations in Inpp5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Inpp5b	APN	4	124784375	missense	possibly damaging	0.94
IGL00696:Inpp5b	APN	4	124742535	start codon destroyed	probably null	1.00
IGL00969:Inpp5b	APN	4	124783994	missense	probably damaging	1.00
IGL01401:Inpp5b	APN	4	124746087	missense	probably damaging	0.97
IGL01481:Inpp5b	APN	4	124800699	splice site	probably null
IGL01517:Inpp5b	APN	4	124782436	missense	probably benign	0.00
IGL03085:Inpp5b	APN	4	124792322	missense	probably benign	0.01
IGL03178:Inpp5b	APN	4	124785254	missense	probably benign	0.02
reduced	UTSW	4	124792252	missense	probably damaging	1.00
P0042:Inpp5b	UTSW	4	124797910	critical splice donor site	probably null
R0504:Inpp5b	UTSW	4	124782408	nonsense	probably null
R0531:Inpp5b	UTSW	4	124795456	missense	probably damaging	0.99
R1396:Inpp5b	UTSW	4	124789080	missense	probably damaging	1.00
R1626:Inpp5b	UTSW	4	124783903	missense	probably damaging	1.00
R1768:Inpp5b	UTSW	4	124793276	nonsense	probably null
R2037:Inpp5b	UTSW	4	124798299	missense	probably damaging	0.98
R2119:Inpp5b	UTSW	4	124797869	missense	probably benign	0.00
R2132:Inpp5b	UTSW	4	124785168	splice site	probably benign
R2190:Inpp5b	UTSW	4	124785195	missense	probably damaging	1.00
R3237:Inpp5b	UTSW	4	124780486	missense	probably benign	0.04
R3800:Inpp5b	UTSW	4	124785345	missense	probably damaging	1.00
R4735:Inpp5b	UTSW	4	124783967	missense	probably damaging	0.99
R4827:Inpp5b	UTSW	4	124743850	intron	probably benign
R4865:Inpp5b	UTSW	4	124751495	missense	probably benign
R4868:Inpp5b	UTSW	4	124751410	missense	probably damaging	0.99
R4913:Inpp5b	UTSW	4	124780421	missense	probably benign	0.09
R5055:Inpp5b	UTSW	4	124743031	critical splice donor site	probably null
R5068:Inpp5b	UTSW	4	124742649	splice site	probably null
R5642:Inpp5b	UTSW	4	124782436	missense	probably benign	0.00
R5875:Inpp5b	UTSW	4	124780406	missense	possibly damaging	0.66
R6015:Inpp5b	UTSW	4	124798350	missense	possibly damaging	0.94
R6288:Inpp5b	UTSW	4	124785227	missense	probably benign	0.00
R6450:Inpp5b	UTSW	4	124792252	missense	probably damaging	1.00
R7138:Inpp5b	UTSW	4	124785272	missense	probably damaging	1.00
R7235:Inpp5b	UTSW	4	124751392	missense	probably benign	0.04
R7382:Inpp5b	UTSW	4	124751577	missense	probably benign	0.00
R7659:Inpp5b	UTSW	4	124795426	missense	probably damaging	1.00
R7806:Inpp5b	UTSW	4	124785088	splice site	probably null
R8348:Inpp5b	UTSW	4	124785174	missense	probably damaging	1.00
R8509:Inpp5b	UTSW	4	124743905	critical splice donor site	probably null
Z1176:Inpp5b	UTSW	4	124797840	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGCTGCATCTGGTTAAGTCTC -3'
(R):5'- CGCCCCAAAGCAGAATGTAG -3'

Sequencing Primer
(F):5'- AATGAATCAGTCCTGCTTTGGC -3'
(R):5'- AATGTAGCCAGGGCCCCTAG -3'

Posted On

2016-07-22