Incidental Mutation 'R0415:Pax5'
ID40215
Institutional Source Beutler Lab
Gene Symbol Pax5
Ensembl Gene ENSMUSG00000014030
Gene Namepaired box 5
SynonymsPax-5, EBB-1
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0415 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44524757-44710487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44691886 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 120 (A120V)
Ref Sequence ENSEMBL: ENSMUSP00000103457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014174] [ENSMUST00000102932] [ENSMUST00000107825] [ENSMUST00000107826] [ENSMUST00000107827] [ENSMUST00000134968] [ENSMUST00000143235] [ENSMUST00000146335] [ENSMUST00000165417] [ENSMUST00000173733] [ENSMUST00000173821] [ENSMUST00000174242] [ENSMUST00000186542]
Predicted Effect probably benign
Transcript: ENSMUST00000014174
AA Change: A120V

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 279 390 6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102932
AA Change: A120V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 276 341 1.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107825
AA Change: A120V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
Pfam:Pax2_C 279 356 5.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107826
AA Change: A120V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 7e-4 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107827
AA Change: A120V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 4e-4 SMART
low complexity region 298 310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134968
AA Change: A120V

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 298 2.4e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143235
AA Change: A120V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146335
AA Change: A119V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139296
Gene: ENSMUSG00000014030
AA Change: A119V

DomainStartEndE-ValueType
PAX 15 139 8e-96 SMART
low complexity region 156 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165417
AA Change: A120V

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 347 7.3e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000172866
AA Change: A64V
SMART Domains Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030
AA Change: A64V

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 7e-5 SMART
Pfam:Pax2_C 224 335 2.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173733
SMART Domains Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 120 2.93e-30 SMART
SCOP:d1ftt__ 154 188 1e-4 SMART
Pfam:Pax2_C 212 290 8.7e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173821
AA Change: A120V

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174242
AA Change: A120V

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030
AA Change: A120V

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174761
Predicted Effect unknown
Transcript: ENSMUST00000174319
AA Change: A64V
SMART Domains Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030
AA Change: A64V

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 2e-4 SMART
low complexity region 251 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191036
Predicted Effect probably benign
Transcript: ENSMUST00000186542
SMART Domains Protein: ENSMUSP00000141186
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 15 108 1.2e-22 SMART
Meta Mutation Damage Score 0.2915 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Fryl T C 5: 73,098,414 Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pth2r A G 1: 65,388,439 M424V probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rad51c A G 11: 87,397,655 L234P probably damaging Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Sfswap A T 5: 129,504,126 D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Trove2 G T 1: 143,760,075 N444K probably benign Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Pax5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Pax5 APN 4 44691919 missense probably damaging 1.00
IGL02700:Pax5 APN 4 44682722 missense probably damaging 0.99
IGL02754:Pax5 APN 4 44570059 missense probably damaging 0.96
apple UTSW 4 unclassified
Glacier UTSW 4 44679494 missense probably damaging 1.00
glacier2 UTSW 4 44710407 start codon destroyed probably null 0.96
Glacier3 UTSW 4 44679526 missense probably damaging 1.00
k2 UTSW 4 44697630 missense probably damaging 1.00
menshevik UTSW 4 44570071 missense probably damaging 1.00
Son_of_apple UTSW 4 44710583 unclassified probably benign
R0411:Pax5 UTSW 4 44609783 missense probably damaging 0.99
R0655:Pax5 UTSW 4 44537462 missense probably damaging 0.97
R1146:Pax5 UTSW 4 44697512 splice site probably benign
R1752:Pax5 UTSW 4 44609729 missense probably damaging 1.00
R1891:Pax5 UTSW 4 44691859 missense probably damaging 1.00
R4766:Pax5 UTSW 4 44679494 missense probably damaging 1.00
R4783:Pax5 UTSW 4 44570086 missense probably damaging 1.00
R5134:Pax5 UTSW 4 44710407 start codon destroyed probably null 0.96
R5341:Pax5 UTSW 4 44697630 missense probably damaging 1.00
R5458:Pax5 UTSW 4 44679526 missense probably damaging 1.00
R6281:Pax5 UTSW 4 44691955 missense probably benign 0.37
R6871:Pax5 UTSW 4 44710583 unclassified probably benign
R7025:Pax5 UTSW 4 44679501 nonsense probably null
R7204:Pax5 UTSW 4 44679485 missense possibly damaging 0.93
R7975:Pax5 UTSW 4 44537465 missense probably damaging 0.98
R8246:Pax5 UTSW 4 44570027 missense probably benign 0.08
R8527:Pax5 UTSW 4 44570071 missense probably damaging 1.00
R8542:Pax5 UTSW 4 44570071 missense probably damaging 1.00
S24628:Pax5 UTSW 4 44691886 missense probably damaging 1.00
X0018:Pax5 UTSW 4 44691880 missense probably damaging 1.00
Z1176:Pax5 UTSW 4 44697678 missense probably damaging 1.00
Z1177:Pax5 UTSW 4 44697558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTGATGTCCTCTCCCAGTAG -3'
(R):5'- TTTGCGGGCTCACATGGCTAAC -3'

Sequencing Primer
(F):5'- TAGCTGAGTCCAGCACTGTC -3'
(R):5'- CAAACCAAAGGTTGCCACTC -3'
Posted On2013-05-23