Incidental Mutation 'R5208:Chrdl2'
ID402153
Institutional Source Beutler Lab
Gene Symbol Chrdl2
Ensembl Gene ENSMUSG00000030732
Gene Namechordin-like 2
Synonyms1810022C01Rik, Chl2
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100006172-100034728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100023922 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 175 (D175G)
Ref Sequence ENSEMBL: ENSMUSP00000102699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032977
AA Change: D168G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732
AA Change: D168G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 33 95 1.13e-3 SMART
VWC 111 174 1.58e-1 SMART
low complexity region 207 219 N/A INTRINSIC
VWC 248 310 3.09e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107084
AA Change: D175G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732
AA Change: D175G

DomainStartEndE-ValueType
VWC 40 102 1.13e-3 SMART
VWC 118 181 1.58e-1 SMART
low complexity region 214 226 N/A INTRINSIC
VWC 255 317 3.09e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000144808
AA Change: D27G
SMART Domains Protein: ENSMUSP00000120760
Gene: ENSMUSG00000030732
AA Change: D27G

DomainStartEndE-ValueType
Blast:VWC 2 34 2e-15 BLAST
low complexity region 67 79 N/A INTRINSIC
low complexity region 96 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Chrdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chrdl2 APN 7 100034641 missense probably damaging 0.96
IGL00965:Chrdl2 APN 7 100006653 splice site probably null
IGL01320:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01322:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01977:Chrdl2 APN 7 100022056 missense probably benign 0.33
IGL02170:Chrdl2 APN 7 100034614 missense possibly damaging 0.92
IGL02478:Chrdl2 APN 7 100020983 critical splice donor site probably null
IGL02745:Chrdl2 APN 7 100020963 missense probably damaging 1.00
IGL03117:Chrdl2 APN 7 100027580 missense possibly damaging 0.83
IGL03377:Chrdl2 APN 7 100022052 missense probably benign 0.03
Measley UTSW 7 100010121 critical splice donor site probably null
R1453:Chrdl2 UTSW 7 100016990 missense possibly damaging 0.64
R1900:Chrdl2 UTSW 7 100033664 missense possibly damaging 0.75
R2092:Chrdl2 UTSW 7 100020977 nonsense probably null
R3421:Chrdl2 UTSW 7 100023868 missense probably damaging 1.00
R3949:Chrdl2 UTSW 7 100029205 missense possibly damaging 0.89
R4305:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4306:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4776:Chrdl2 UTSW 7 100006541 unclassified probably benign
R5327:Chrdl2 UTSW 7 100028741 missense probably damaging 1.00
R5859:Chrdl2 UTSW 7 100020907 missense probably damaging 1.00
R5928:Chrdl2 UTSW 7 100009993 start gained probably benign
R6706:Chrdl2 UTSW 7 100010121 critical splice donor site probably null
R7027:Chrdl2 UTSW 7 100022033 missense probably damaging 1.00
R7039:Chrdl2 UTSW 7 100028672 missense probably damaging 1.00
R7357:Chrdl2 UTSW 7 100029207 missense probably benign 0.00
R7468:Chrdl2 UTSW 7 100010125 splice site probably null
R7840:Chrdl2 UTSW 7 100033656 missense probably damaging 0.99
R7870:Chrdl2 UTSW 7 100010042 missense unknown
R7887:Chrdl2 UTSW 7 100029250 missense possibly damaging 0.89
R8394:Chrdl2 UTSW 7 100017085 missense possibly damaging 0.95
R8436:Chrdl2 UTSW 7 100027733 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAAGGGTATTTGCTCCCAGG -3'
(R):5'- AGCCTTTGGGAAGATTCAGG -3'

Sequencing Primer
(F):5'- TATTTGCTCCCAGGGAAAGAGGC -3'
(R):5'- ACAAGTGACAGTCCGTCTTTGAG -3'
Posted On2016-07-22