Mutagenetix > Incidental Mutations

Incidental Mutation 'R5208:Chrdl2'

402153

Institutional Source

Beutler Lab

Gene Symbol

Chrdl2

Ensembl Gene

ENSMUSG00000030732

Gene Name

chordin-like 2

Synonyms

1810022C01Rik, Chl2

MMRRC Submission

042783-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.288) question?

Stock #

R5208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100006172-100034728 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100023922 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 175 (D175G)

Ref Sequence

ENSEMBL: ENSMUSP00000102699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032977
AA Change: D168G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732
AA Change: D168G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWC	33	95	1.13e-3	SMART
VWC	111	174	1.58e-1	SMART
low complexity region	207	219	N/A	INTRINSIC
VWC	248	310	3.09e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107084
AA Change: D175G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732
AA Change: D175G

Domain	Start	End	E-Value	Type
VWC	40	102	1.13e-3	SMART
VWC	118	181	1.58e-1	SMART
low complexity region	214	226	N/A	INTRINSIC
VWC	255	317	3.09e-10	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000144808
AA Change: D27G

SMART Domains

Protein: ENSMUSP00000120760
Gene: ENSMUSG00000030732
AA Change: D27G

Domain	Start	End	E-Value	Type
Blast:VWC	2	34	2e-15	BLAST
low complexity region	67	79	N/A	INTRINSIC
low complexity region	96	114	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	C	A	7: 140,298,036	A977D	probably benign	Het
Aadacl4	A	T	4: 144,617,828	N58I	probably benign	Het
Adgra3	T	C	5: 50,011,515	D163G	probably damaging	Het
Alcam	C	A	16: 52,295,048	E236*	probably null	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Aplf	G	T	6: 87,642,026		probably null	Het
Arl4a	A	T	12: 40,036,745	M1K	probably null	Het
Asic4	A	G	1: 75,451,226	D132G	probably damaging	Het
Bbs12	T	C	3: 37,320,273	I290T	probably benign	Het
BC024139	A	G	15: 76,124,665	S290P	probably benign	Het
Bmp6	G	A	13: 38,469,697	A247T	probably benign	Het
Cadps	A	G	14: 12,457,711	S1057P	possibly damaging	Het
Caprin1	A	C	2: 103,769,433		probably null	Het
Cdc42bpg	G	A	19: 6,321,720	R1343K	probably benign	Het
Cdk18	A	T	1: 132,117,480		probably null	Het
Cenpf	A	T	1: 189,671,046		probably null	Het
Cfhr1	A	T	1: 139,556,330		probably null	Het
Chn2	A	T	6: 54,295,801	I201F	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah3	C	G	7: 120,032,638	D1365H	probably damaging	Het
Efcab8	T	A	2: 153,802,423	Y372*	probably null	Het
Eftud2	G	A	11: 102,841,185	P768S	probably damaging	Het
Ehmt1	A	C	2: 24,801,533	S1170A	probably benign	Het
Gdpd4	A	C	7: 98,014,911	K572Q	probably benign	Het
Gm7356	T	C	17: 14,001,194	E191G	probably damaging	Het
Gm8674	A	T	13: 49,901,921		noncoding transcript	Het
Gulp1	T	G	1: 44,781,039	H235Q	probably benign	Het
Hormad1	T	C	3: 95,578,107	V202A	possibly damaging	Het
Inpp5b	G	A	4: 124,751,317	D179N	possibly damaging	Het
Kcnk4	T	A	19: 6,927,701	Y194F	possibly damaging	Het
Lars	A	C	18: 42,217,557	S896A	probably benign	Het
Lonp1	A	G	17: 56,617,793	V538A	probably damaging	Het
Map3k14	A	T	11: 103,239,146	L315Q	probably damaging	Het
Met	T	A	6: 17,526,423	Y500*	probably null	Het
Mga	T	G	2: 119,947,981	I2093M	possibly damaging	Het
Mpl	T	G	4: 118,455,881	I152L	probably benign	Het
Mthfsd	G	A	8: 121,108,319		probably benign	Het
Mup4	A	G	4: 59,958,119	F150L	probably damaging	Het
Mybph	T	A	1: 134,193,535	V11D	probably benign	Het
Olfr1278	A	T	2: 111,292,601	E111V	probably damaging	Het
Olfr668	A	G	7: 104,925,726	F13L	probably benign	Het
Olfr988	T	A	2: 85,353,798	I43F	probably benign	Het
Pde4a	T	C	9: 21,203,558		probably null	Het
Pex2	C	T	3: 5,561,368	R127H	probably benign	Het
Pgap3	A	G	11: 98,398,048	W94R	probably damaging	Het
Prl4a1	T	C	13: 28,018,484	V14A	probably benign	Het
Psg25	A	T	7: 18,526,535	I146N	probably benign	Het
Ptprn2	A	G	12: 116,858,928	Y209C	probably damaging	Het
Sema4c	T	A	1: 36,550,326	D573V	probably damaging	Het
Setx	A	T	2: 29,166,367	I2192F	possibly damaging	Het
Sp4	A	G	12: 118,299,546	L255P	probably damaging	Het
Spaca7	A	G	8: 12,586,456	Y94C	probably damaging	Het
Stt3a	T	G	9: 36,746,595	I390L	possibly damaging	Het
Tars2	A	G	3: 95,747,593	W128R	probably damaging	Het
Tll1	G	A	8: 64,051,493	T623M	probably damaging	Het
Tmem129	A	T	5: 33,655,506	V166E	probably damaging	Het
Tmem200a	T	A	10: 25,994,153	I73F	probably benign	Het
Tnks1bp1	T	C	2: 85,070,632	M1561T	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Zfat	A	T	15: 68,180,721	I401N	probably damaging	Het
Zfp142	A	T	1: 74,570,868	V1153E	probably benign	Het
Zwilch	T	C	9: 64,152,923	I354V	probably benign	Het

Other mutations in Chrdl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Chrdl2	APN	7	100034641	missense	probably damaging	0.96
IGL00965:Chrdl2	APN	7	100006653	splice site	probably null
IGL01320:Chrdl2	APN	7	100017041	missense	probably damaging	1.00
IGL01322:Chrdl2	APN	7	100017041	missense	probably damaging	1.00
IGL01977:Chrdl2	APN	7	100022056	missense	probably benign	0.33
IGL02170:Chrdl2	APN	7	100034614	missense	possibly damaging	0.92
IGL02478:Chrdl2	APN	7	100020983	critical splice donor site	probably null
IGL02745:Chrdl2	APN	7	100020963	missense	probably damaging	1.00
IGL03117:Chrdl2	APN	7	100027580	missense	possibly damaging	0.83
IGL03377:Chrdl2	APN	7	100022052	missense	probably benign	0.03
Measley	UTSW	7	100010121	critical splice donor site	probably null
R1453:Chrdl2	UTSW	7	100016990	missense	possibly damaging	0.64
R1900:Chrdl2	UTSW	7	100033664	missense	possibly damaging	0.75
R2092:Chrdl2	UTSW	7	100020977	nonsense	probably null
R3421:Chrdl2	UTSW	7	100023868	missense	probably damaging	1.00
R3949:Chrdl2	UTSW	7	100029205	missense	possibly damaging	0.89
R4305:Chrdl2	UTSW	7	100022022	missense	probably damaging	1.00
R4306:Chrdl2	UTSW	7	100022022	missense	probably damaging	1.00
R4776:Chrdl2	UTSW	7	100006541	unclassified	probably benign
R5327:Chrdl2	UTSW	7	100028741	missense	probably damaging	1.00
R5859:Chrdl2	UTSW	7	100020907	missense	probably damaging	1.00
R5928:Chrdl2	UTSW	7	100009993	start gained	probably benign
R6706:Chrdl2	UTSW	7	100010121	critical splice donor site	probably null
R7027:Chrdl2	UTSW	7	100022033	missense	probably damaging	1.00
R7039:Chrdl2	UTSW	7	100028672	missense	probably damaging	1.00
R7357:Chrdl2	UTSW	7	100029207	missense	probably benign	0.00
R7468:Chrdl2	UTSW	7	100010125	splice site	probably null
R7840:Chrdl2	UTSW	7	100033656	missense	probably damaging	0.99
R7870:Chrdl2	UTSW	7	100010042	missense	unknown
R7887:Chrdl2	UTSW	7	100029250	missense	possibly damaging	0.89
R8394:Chrdl2	UTSW	7	100017085	missense	possibly damaging	0.95
R8436:Chrdl2	UTSW	7	100027733	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTAAGGGTATTTGCTCCCAGG -3'
(R):5'- AGCCTTTGGGAAGATTCAGG -3'

Sequencing Primer
(F):5'- TATTTGCTCCCAGGGAAAGAGGC -3'
(R):5'- ACAAGTGACAGTCCGTCTTTGAG -3'

Posted On

2016-07-22