Incidental Mutation 'R5208:Mthfsd'
ID402159
Institutional Source Beutler Lab
Gene Symbol Mthfsd
Ensembl Gene ENSMUSG00000031816
Gene Namemethenyltetrahydrofolate synthetase domain containing
Synonyms
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location121091628-121108392 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 121108319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047282] [ENSMUST00000116415] [ENSMUST00000126431] [ENSMUST00000127664] [ENSMUST00000128052] [ENSMUST00000133037] [ENSMUST00000134758] [ENSMUST00000139782] [ENSMUST00000151576]
Predicted Effect probably benign
Transcript: ENSMUST00000047282
SMART Domains Protein: ENSMUSP00000044172
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 1.1e-31 PFAM
RRM 278 346 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116415
SMART Domains Protein: ENSMUSP00000112116
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 2.3e-36 PFAM
RRM 297 365 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126431
SMART Domains Protein: ENSMUSP00000119673
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:5-FTHF_cyc-lig 81 278 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128503
Predicted Effect probably benign
Transcript: ENSMUST00000133037
SMART Domains Protein: ENSMUSP00000117429
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 7.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138908
Predicted Effect probably benign
Transcript: ENSMUST00000139782
SMART Domains Protein: ENSMUSP00000115382
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 2.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149718
Predicted Effect probably benign
Transcript: ENSMUST00000151576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156606
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Mthfsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Mthfsd APN 8 121104468 missense probably damaging 1.00
IGL03002:Mthfsd APN 8 121108279 splice site probably benign
R0076:Mthfsd UTSW 8 121098739 missense probably benign 0.04
R0416:Mthfsd UTSW 8 121101237 missense probably damaging 1.00
R0745:Mthfsd UTSW 8 121102949 missense probably damaging 1.00
R2157:Mthfsd UTSW 8 121101501 missense probably damaging 1.00
R2851:Mthfsd UTSW 8 121105773 missense probably benign 0.38
R3439:Mthfsd UTSW 8 121099121 missense possibly damaging 0.89
R4207:Mthfsd UTSW 8 121105626 missense probably damaging 1.00
R4456:Mthfsd UTSW 8 121105765 missense possibly damaging 0.89
R4757:Mthfsd UTSW 8 121098998 critical splice donor site probably null
R5154:Mthfsd UTSW 8 121098740 missense probably damaging 1.00
R5496:Mthfsd UTSW 8 121098814 nonsense probably null
R6652:Mthfsd UTSW 8 121098821 missense probably damaging 1.00
R7309:Mthfsd UTSW 8 121108331 unclassified probably benign
R7538:Mthfsd UTSW 8 121098786 missense probably benign 0.41
R8072:Mthfsd UTSW 8 121098816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTGGCTAAAACCTGTC -3'
(R):5'- GACCTCTGGTCCTCTAATGC -3'

Sequencing Primer
(F):5'- TGGCTAAAACCTGTCCAGCC -3'
(R):5'- AATGCGTCGGTGCTACTAC -3'
Posted On2016-07-22