Mutagenetix > Incidental Mutation

Incidental Mutation 'R0415:Cfap57'

40216

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

038617-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0415 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118569431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1107 (L1107Q)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071972
AA Change: L1107Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: L1107Q

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081921
AA Change: L1107Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: L1107Q

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.2268

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (99/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427G23Rik	A	T	5: 23,831,050		noncoding transcript	Het
Acox2	A	G	14: 8,243,835		probably benign	Het
Adgb	T	C	10: 10,431,067		probably null	Het
Adgra3	C	A	5: 49,961,757		probably benign	Het
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ahnak	A	G	19: 9,012,871		probably benign	Het
Anapc2	A	G	2: 25,278,325	T159A	probably damaging	Het
Arfgef3	A	G	10: 18,613,127		probably benign	Het
Atf7ip	C	T	6: 136,560,012	S81L	possibly damaging	Het
Cacna1i	A	G	15: 80,368,830		probably benign	Het
Camk1	A	T	6: 113,341,891	Y20*	probably null	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
Cd109	T	A	9: 78,712,615	S1380T	probably benign	Het
Col6a4	C	T	9: 106,075,080	V540I	probably damaging	Het
Cst9	T	A	2: 148,838,442		probably benign	Het
Cul5	C	T	9: 53,667,070	V73I	probably benign	Het
Cxcl16	T	A	11: 70,458,748	K84*	probably null	Het
Cyp2c29	T	C	19: 39,329,095		probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dip2c	C	T	13: 9,568,289		probably benign	Het
Dis3	A	T	14: 99,087,456	I513N	probably damaging	Het
Dnajc16	A	T	4: 141,789,048	L3*	probably null	Het
Dopey1	T	A	9: 86,506,502	L480M	probably damaging	Het
Eml6	A	G	11: 29,749,392	V1787A	possibly damaging	Het
Etnk1	A	G	6: 143,180,774	N115S	probably damaging	Het
Fryl	T	C	5: 73,098,414	Y758C	probably damaging	Het
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Ggnbp2	A	C	11: 84,833,225		probably benign	Het
Gm7137	A	G	10: 77,788,173		probably benign	Het
Gstm2	T	A	3: 107,984,006	Q132L	probably benign	Het
Habp2	T	C	19: 56,317,717		probably benign	Het
Hectd2	T	C	19: 36,584,884		probably benign	Het
Htr6	A	G	4: 139,062,081	I291T	possibly damaging	Het
Ighg2c	T	C	12: 113,287,910	D199G	unknown	Het
Itih2	A	G	2: 10,105,615		probably benign	Het
Kcnab2	A	G	4: 152,395,136	F248S	probably benign	Het
Kcnc4	T	C	3: 107,445,433	K610E	probably damaging	Het
Kcnk16	T	A	14: 20,262,975		probably null	Het
Kndc1	C	T	7: 139,930,124	T1293I	probably damaging	Het
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Lrrc8d	T	C	5: 105,811,865	L47P	probably damaging	Het
Lyst	T	C	13: 13,711,610		probably benign	Het
Macrod2	G	A	2: 142,210,145		probably null	Het
Micalcl	C	T	7: 112,381,028	R70C	probably damaging	Het
Mllt3	ACTGCTGCTGCTGCTGCTGCT	ACTGCTGCTGCTGCTGCT	4: 87,841,339		probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nup205	T	C	6: 35,214,634		probably benign	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Olfr229	A	G	9: 39,909,983	Y60C	probably damaging	Het
Olfr78	C	T	7: 102,742,087	M305I	probably benign	Het
Olfr893	A	T	9: 38,209,973	M305L	probably benign	Het
Pard3	G	A	8: 127,610,566	G1221D	probably damaging	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Pcsk6	C	T	7: 66,033,874	R746C	probably damaging	Het
Pif1	G	A	9: 65,588,051	C81Y	probably benign	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plcd4	C	A	1: 74,552,097	S217Y	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Het
Polr2k	A	G	15: 36,175,456	Y45C	probably damaging	Het
Pqlc3	C	A	12: 16,997,710		probably benign	Het
Prex1	A	G	2: 166,586,699		probably benign	Het
Pth2r	A	G	1: 65,388,439	M424V	probably benign	Het
Pygm	A	G	19: 6,391,366	R464G	probably benign	Het
Rad51c	A	G	11: 87,397,655	L234P	probably damaging	Het
Rnf145	A	G	11: 44,525,138	Y60C	probably damaging	Het
Rnf167	T	C	11: 70,649,699	I135T	probably damaging	Het
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Het
Selenbp1	T	C	3: 94,936,913	V27A	possibly damaging	Het
Selenof	T	G	3: 144,577,692	L14R	probably damaging	Het
Sfswap	A	T	5: 129,504,126	D121V	probably damaging	Het
Slc25a34	C	A	4: 141,620,469	M300I	possibly damaging	Het
Slc34a3	T	G	2: 25,229,110	T583P	probably benign	Het
Smg1	C	A	7: 118,182,468	A1199S	probably benign	Het
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Sptbn1	A	C	11: 30,149,576	N229K	probably damaging	Het
Sult2b1	A	G	7: 45,730,092		probably benign	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem132c	A	G	5: 127,563,705	E980G	probably damaging	Het
Tmem247	G	T	17: 86,922,322	C197F	probably damaging	Het
Tmem251	T	A	12: 102,744,876	Y119*	probably null	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Het
Tmprss13	A	G	9: 45,337,132		probably null	Het
Trove2	G	T	1: 143,760,075	N444K	probably benign	Het
Ubr5	T	C	15: 37,972,980	T2626A	probably damaging	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Het
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Het
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Vmn2r74	A	C	7: 85,961,410	C25G	probably damaging	Het
Xndc1	T	C	7: 102,080,616		probably benign	Het
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Het
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Het
Zfp316	T	A	5: 143,264,491	T56S	unknown	Het
Zfp345	A	G	2: 150,474,559		probably benign	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGTGACAGCCAGGATGAGCTAC -3'
(R):5'- TCCGACGCTTCAAGACAGACCTTC -3'

Sequencing Primer
(F):5'- GCCAGGATGAGCTACTGGAG -3'
(R):5'- AGAAGATCCGTGGCCTCTTTG -3'

Posted On

2013-05-23