Mutagenetix > Incidental Mutation

Incidental Mutation 'R5208:Ptprn2'

402170

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

042783-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R5208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116858928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 209 (Y209C)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably damaging
Transcript: ENSMUST00000070733
AA Change: Y209C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: Y209C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189009

Predicted Effect

probably damaging
Transcript: ENSMUST00000190247
AA Change: Y209C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: Y209C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	C	A	7: 140,298,036	A977D	probably benign	Het
Aadacl4	A	T	4: 144,617,828	N58I	probably benign	Het
Adgra3	T	C	5: 50,011,515	D163G	probably damaging	Het
Alcam	C	A	16: 52,295,048	E236*	probably null	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Aplf	G	T	6: 87,642,026		probably null	Het
Arl4a	A	T	12: 40,036,745	M1K	probably null	Het
Asic4	A	G	1: 75,451,226	D132G	probably damaging	Het
Bbs12	T	C	3: 37,320,273	I290T	probably benign	Het
BC024139	A	G	15: 76,124,665	S290P	probably benign	Het
Bmp6	G	A	13: 38,469,697	A247T	probably benign	Het
Cadps	A	G	14: 12,457,711	S1057P	possibly damaging	Het
Caprin1	A	C	2: 103,769,433		probably null	Het
Cdc42bpg	G	A	19: 6,321,720	R1343K	probably benign	Het
Cdk18	A	T	1: 132,117,480		probably null	Het
Cenpf	A	T	1: 189,671,046		probably null	Het
Cfhr1	A	T	1: 139,556,330		probably null	Het
Chn2	A	T	6: 54,295,801	I201F	probably damaging	Het
Chrdl2	A	G	7: 100,023,922	D175G	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah3	C	G	7: 120,032,638	D1365H	probably damaging	Het
Efcab8	T	A	2: 153,802,423	Y372*	probably null	Het
Eftud2	G	A	11: 102,841,185	P768S	probably damaging	Het
Ehmt1	A	C	2: 24,801,533	S1170A	probably benign	Het
Gdpd4	A	C	7: 98,014,911	K572Q	probably benign	Het
Gm7356	T	C	17: 14,001,194	E191G	probably damaging	Het
Gm8674	A	T	13: 49,901,921		noncoding transcript	Het
Gulp1	T	G	1: 44,781,039	H235Q	probably benign	Het
Hormad1	T	C	3: 95,578,107	V202A	possibly damaging	Het
Inpp5b	G	A	4: 124,751,317	D179N	possibly damaging	Het
Kcnk4	T	A	19: 6,927,701	Y194F	possibly damaging	Het
Lars	A	C	18: 42,217,557	S896A	probably benign	Het
Lonp1	A	G	17: 56,617,793	V538A	probably damaging	Het
Map3k14	A	T	11: 103,239,146	L315Q	probably damaging	Het
Met	T	A	6: 17,526,423	Y500*	probably null	Het
Mga	T	G	2: 119,947,981	I2093M	possibly damaging	Het
Mpl	T	G	4: 118,455,881	I152L	probably benign	Het
Mthfsd	G	A	8: 121,108,319		probably benign	Het
Mup4	A	G	4: 59,958,119	F150L	probably damaging	Het
Mybph	T	A	1: 134,193,535	V11D	probably benign	Het
Olfr1278	A	T	2: 111,292,601	E111V	probably damaging	Het
Olfr668	A	G	7: 104,925,726	F13L	probably benign	Het
Olfr988	T	A	2: 85,353,798	I43F	probably benign	Het
Pde4a	T	C	9: 21,203,558		probably null	Het
Pex2	C	T	3: 5,561,368	R127H	probably benign	Het
Pgap3	A	G	11: 98,398,048	W94R	probably damaging	Het
Prl4a1	T	C	13: 28,018,484	V14A	probably benign	Het
Psg25	A	T	7: 18,526,535	I146N	probably benign	Het
Sema4c	T	A	1: 36,550,326	D573V	probably damaging	Het
Setx	A	T	2: 29,166,367	I2192F	possibly damaging	Het
Sp4	A	G	12: 118,299,546	L255P	probably damaging	Het
Spaca7	A	G	8: 12,586,456	Y94C	probably damaging	Het
Stt3a	T	G	9: 36,746,595	I390L	possibly damaging	Het
Tars2	A	G	3: 95,747,593	W128R	probably damaging	Het
Tll1	G	A	8: 64,051,493	T623M	probably damaging	Het
Tmem129	A	T	5: 33,655,506	V166E	probably damaging	Het
Tmem200a	T	A	10: 25,994,153	I73F	probably benign	Het
Tnks1bp1	T	C	2: 85,070,632	M1561T	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Zfat	A	T	15: 68,180,721	I401N	probably damaging	Het
Zfp142	A	T	1: 74,570,868	V1153E	probably benign	Het
Zwilch	T	C	9: 64,152,923	I354V	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TAAGAAGTGTGGAGCTTGGC -3'
(R):5'- GCGGAACCATGTACAAGGTACC -3'

Sequencing Primer
(F):5'- AGAGAAGCTTTCTGCCACTG -3'
(R):5'- ATGTACAAGGTACCGTGGCTC -3'

Posted On

2016-07-22