Incidental Mutation 'R5208:Sp4'
ID402171
Institutional Source Beutler Lab
Gene Symbol Sp4
Ensembl Gene ENSMUSG00000025323
Gene Nametrans-acting transcription factor 4
Synonyms5730497N03Rik, HF1-b, HF-1b
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118234933-118301440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118299546 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 255 (L255P)
Ref Sequence ENSEMBL: ENSMUSP00000152603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026367] [ENSMUST00000221844] [ENSMUST00000222314]
Predicted Effect probably damaging
Transcript: ENSMUST00000026367
AA Change: L255P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026367
Gene: ENSMUSG00000025323
AA Change: L255P

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 146 N/A INTRINSIC
internal_repeat_1 157 255 4.15e-6 PROSPERO
internal_repeat_2 203 265 5.92e-5 PROSPERO
low complexity region 272 296 N/A INTRINSIC
low complexity region 300 342 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
low complexity region 392 421 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
internal_repeat_2 451 506 5.92e-5 PROSPERO
internal_repeat_1 461 539 4.15e-6 PROSPERO
low complexity region 540 549 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
low complexity region 629 638 N/A INTRINSIC
ZnF_C2H2 645 669 2.82e0 SMART
ZnF_C2H2 675 699 7.37e-4 SMART
ZnF_C2H2 705 727 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221844
Predicted Effect probably damaging
Transcript: ENSMUST00000222314
AA Change: L255P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can bind to the GC promoter region of a variety of genes, including those of the photoreceptor signal transduction system. The encoded protein binds to the same sites in promoter CpG islands as does the transcription factor SP1, although its expression is much more restricted compared to that of SP1. This gene may be involved in bipolar disorder and schizophrenia. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac arrhythmias and most die shortly after birth. Surviving males complete spermatogenesis but do not copulate, while females show delayed sexual maturation and reduction in spleen, thymus, and uterus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Sp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sp4 APN 12 118299549 missense probably damaging 0.99
IGL02817:Sp4 APN 12 118299552 missense probably damaging 1.00
IGL02833:Sp4 APN 12 118261881 missense probably benign 0.05
Deadloss UTSW 12 118254439 missense possibly damaging 0.82
Speck UTSW 12 118300811 splice site probably null
R0128:Sp4 UTSW 12 118300816 splice site probably benign
R0130:Sp4 UTSW 12 118300816 splice site probably benign
R0398:Sp4 UTSW 12 118298673 missense possibly damaging 0.79
R0626:Sp4 UTSW 12 118299579 missense probably damaging 1.00
R1193:Sp4 UTSW 12 118299246 missense possibly damaging 0.94
R1775:Sp4 UTSW 12 118299600 missense probably damaging 0.99
R4724:Sp4 UTSW 12 118261809 missense probably benign
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4969:Sp4 UTSW 12 118299606 missense probably damaging 0.96
R5049:Sp4 UTSW 12 118254472 missense probably benign 0.04
R5178:Sp4 UTSW 12 118261889 missense possibly damaging 0.46
R5722:Sp4 UTSW 12 118299241 missense possibly damaging 0.66
R6318:Sp4 UTSW 12 118238178 missense probably damaging 1.00
R6619:Sp4 UTSW 12 118299342 missense possibly damaging 0.92
R6917:Sp4 UTSW 12 118299173 missense probably damaging 1.00
R7195:Sp4 UTSW 12 118300072 missense possibly damaging 0.92
R7614:Sp4 UTSW 12 118254439 missense possibly damaging 0.82
R7747:Sp4 UTSW 12 118254404 splice site probably null
R7983:Sp4 UTSW 12 118301232 start codon destroyed probably null
Z1177:Sp4 UTSW 12 118300059 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATTCAGGCATAGTACTGGCGG -3'
(R):5'- TGGAAGGCCAGCAAATTCAAATC -3'

Sequencing Primer
(F):5'- CGGGAGCAGTGCTGGTG -3'
(R):5'- TGCAGGGTCAAATTCAGCTC -3'
Posted On2016-07-22