Mutagenetix > Incidental Mutations

Incidental Mutation 'R5208:Ttc37'

402176

Institutional Source

Beutler Lab

Gene Symbol

Ttc37

Ensembl Gene

ENSMUSG00000033991

Gene Name

tetratricopeptide repeat domain 37

Synonyms

MMRRC Submission

042783-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.427) question?

Stock #

R5208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76098734-76190316 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76147767 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1050 (E1050K)

Ref Sequence

ENSEMBL: ENSMUSP00000153521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091466
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: E1050K

Domain	Start	End	E-Value	Type
TPR	6	39	2.92e1	SMART
TPR	40	73	1.1e-1	SMART
TPR	272	305	9.45e0	SMART
TPR	306	339	8.9e-2	SMART
SEL1	420	451	1.45e2	SMART
TPR	420	453	2.55e-2	SMART
SEL1	454	490	1.15e1	SMART
TPR	454	492	2.84e1	SMART
TPR	493	527	1.92e1	SMART
TPR	564	597	7.34e-3	SMART
TPR	598	631	1.81e-2	SMART
TPR	632	665	2.43e1	SMART
low complexity region	728	739	N/A	INTRINSIC
SEL1	861	892	3.58e1	SMART
TPR	861	894	2.14e-4	SMART
TPR	980	1013	1.56e1	SMART
Blast:TPR	1051	1084	7e-11	BLAST
Blast:TPR	1088	1121	7e-10	BLAST
TPR	1399	1432	4.31e0	SMART
low complexity region	1438	1450	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224289

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224386
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	C	A	7: 140,298,036	A977D	probably benign	Het
Aadacl4	A	T	4: 144,617,828	N58I	probably benign	Het
Adgra3	T	C	5: 50,011,515	D163G	probably damaging	Het
Alcam	C	A	16: 52,295,048	E236*	probably null	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Aplf	G	T	6: 87,642,026		probably null	Het
Arl4a	A	T	12: 40,036,745	M1K	probably null	Het
Asic4	A	G	1: 75,451,226	D132G	probably damaging	Het
Bbs12	T	C	3: 37,320,273	I290T	probably benign	Het
BC024139	A	G	15: 76,124,665	S290P	probably benign	Het
Bmp6	G	A	13: 38,469,697	A247T	probably benign	Het
Cadps	A	G	14: 12,457,711	S1057P	possibly damaging	Het
Caprin1	A	C	2: 103,769,433		probably null	Het
Cdc42bpg	G	A	19: 6,321,720	R1343K	probably benign	Het
Cdk18	A	T	1: 132,117,480		probably null	Het
Cenpf	A	T	1: 189,671,046		probably null	Het
Cfhr1	A	T	1: 139,556,330		probably null	Het
Chn2	A	T	6: 54,295,801	I201F	probably damaging	Het
Chrdl2	A	G	7: 100,023,922	D175G	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah3	C	G	7: 120,032,638	D1365H	probably damaging	Het
Efcab8	T	A	2: 153,802,423	Y372*	probably null	Het
Eftud2	G	A	11: 102,841,185	P768S	probably damaging	Het
Ehmt1	A	C	2: 24,801,533	S1170A	probably benign	Het
Gdpd4	A	C	7: 98,014,911	K572Q	probably benign	Het
Gm7356	T	C	17: 14,001,194	E191G	probably damaging	Het
Gm8674	A	T	13: 49,901,921		noncoding transcript	Het
Gulp1	T	G	1: 44,781,039	H235Q	probably benign	Het
Hormad1	T	C	3: 95,578,107	V202A	possibly damaging	Het
Inpp5b	G	A	4: 124,751,317	D179N	possibly damaging	Het
Kcnk4	T	A	19: 6,927,701	Y194F	possibly damaging	Het
Lars	A	C	18: 42,217,557	S896A	probably benign	Het
Lonp1	A	G	17: 56,617,793	V538A	probably damaging	Het
Map3k14	A	T	11: 103,239,146	L315Q	probably damaging	Het
Met	T	A	6: 17,526,423	Y500*	probably null	Het
Mga	T	G	2: 119,947,981	I2093M	possibly damaging	Het
Mpl	T	G	4: 118,455,881	I152L	probably benign	Het
Mthfsd	G	A	8: 121,108,319		probably benign	Het
Mup4	A	G	4: 59,958,119	F150L	probably damaging	Het
Mybph	T	A	1: 134,193,535	V11D	probably benign	Het
Olfr1278	A	T	2: 111,292,601	E111V	probably damaging	Het
Olfr668	A	G	7: 104,925,726	F13L	probably benign	Het
Olfr988	T	A	2: 85,353,798	I43F	probably benign	Het
Pde4a	T	C	9: 21,203,558		probably null	Het
Pex2	C	T	3: 5,561,368	R127H	probably benign	Het
Pgap3	A	G	11: 98,398,048	W94R	probably damaging	Het
Prl4a1	T	C	13: 28,018,484	V14A	probably benign	Het
Psg25	A	T	7: 18,526,535	I146N	probably benign	Het
Ptprn2	A	G	12: 116,858,928	Y209C	probably damaging	Het
Sema4c	T	A	1: 36,550,326	D573V	probably damaging	Het
Setx	A	T	2: 29,166,367	I2192F	possibly damaging	Het
Sp4	A	G	12: 118,299,546	L255P	probably damaging	Het
Spaca7	A	G	8: 12,586,456	Y94C	probably damaging	Het
Stt3a	T	G	9: 36,746,595	I390L	possibly damaging	Het
Tars2	A	G	3: 95,747,593	W128R	probably damaging	Het
Tll1	G	A	8: 64,051,493	T623M	probably damaging	Het
Tmem129	A	T	5: 33,655,506	V166E	probably damaging	Het
Tmem200a	T	A	10: 25,994,153	I73F	probably benign	Het
Tnks1bp1	T	C	2: 85,070,632	M1561T	probably damaging	Het
Zfat	A	T	15: 68,180,721	I401N	probably damaging	Het
Zfp142	A	T	1: 74,570,868	V1153E	probably benign	Het
Zwilch	T	C	9: 64,152,923	I354V	probably benign	Het

Other mutations in Ttc37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ttc37	APN	13	76143278	critical splice donor site	probably null
IGL00650:Ttc37	APN	13	76127507	missense	possibly damaging	0.89
IGL00838:Ttc37	APN	13	76134791	missense	probably damaging	0.99
IGL00958:Ttc37	APN	13	76122745	missense	probably damaging	0.98
IGL01011:Ttc37	APN	13	76122665	missense	probably damaging	0.97
IGL01062:Ttc37	APN	13	76155462	nonsense	probably null
IGL01319:Ttc37	APN	13	76129379	missense	probably benign	0.29
IGL01697:Ttc37	APN	13	76128733	missense	probably benign	0.01
IGL02061:Ttc37	APN	13	76129541	critical splice donor site	probably null
IGL02184:Ttc37	APN	13	76111691	missense	probably damaging	1.00
IGL02309:Ttc37	APN	13	76127047	missense	possibly damaging	0.90
IGL03230:Ttc37	APN	13	76155647	splice site	probably benign
IGL03354:Ttc37	APN	13	76182822	missense	possibly damaging	0.71
caviar	UTSW	13	76147767	missense	possibly damaging	0.54
gourmet	UTSW	13	76150519	missense	probably damaging	1.00
tartare	UTSW	13	76185179	missense	probably damaging	0.96
R0501:Ttc37	UTSW	13	76147806	missense	probably benign
R0628:Ttc37	UTSW	13	76150729	missense	possibly damaging	0.89
R0711:Ttc37	UTSW	13	76182891	missense	probably damaging	1.00
R0928:Ttc37	UTSW	13	76113592	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1524:Ttc37	UTSW	13	76138372	missense	probably benign	0.01
R1628:Ttc37	UTSW	13	76111791	missense	possibly damaging	0.75
R1702:Ttc37	UTSW	13	76122743	missense	possibly damaging	0.66
R1750:Ttc37	UTSW	13	76140601	missense	possibly damaging	0.89
R1822:Ttc37	UTSW	13	76130288	missense	probably benign	0.35
R1885:Ttc37	UTSW	13	76113047	missense	probably benign	0.00
R1885:Ttc37	UTSW	13	76130235	missense	probably benign	0.11
R1923:Ttc37	UTSW	13	76134770	missense	probably damaging	1.00
R1978:Ttc37	UTSW	13	76134815	missense	probably benign	0.00
R2040:Ttc37	UTSW	13	76180103	missense	probably damaging	1.00
R2136:Ttc37	UTSW	13	76173354	missense	possibly damaging	0.87
R2268:Ttc37	UTSW	13	76112274	unclassified	probably benign
R2483:Ttc37	UTSW	13	76182867	missense	probably damaging	1.00
R2988:Ttc37	UTSW	13	76155689	missense	probably benign	0.11
R3701:Ttc37	UTSW	13	76113679	missense	probably benign
R3951:Ttc37	UTSW	13	76130219	missense	probably damaging	1.00
R4405:Ttc37	UTSW	13	76155665	missense	probably damaging	0.97
R4411:Ttc37	UTSW	13	76127504	missense	possibly damaging	0.89
R4957:Ttc37	UTSW	13	76185113	splice site	probably null
R4960:Ttc37	UTSW	13	76185156	missense	possibly damaging	0.95
R4993:Ttc37	UTSW	13	76182936	missense	probably damaging	0.96
R5206:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5302:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5305:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5306:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5579:Ttc37	UTSW	13	76185200	missense	probably damaging	1.00
R5618:Ttc37	UTSW	13	76173426	missense	probably benign
R5726:Ttc37	UTSW	13	76118347	missense	probably damaging	1.00
R5813:Ttc37	UTSW	13	76155733	missense	probably benign	0.05
R5899:Ttc37	UTSW	13	76111819	splice site	probably null
R6146:Ttc37	UTSW	13	76185240	missense	probably damaging	1.00
R6224:Ttc37	UTSW	13	76118291	missense	probably benign	0.02
R6286:Ttc37	UTSW	13	76143240	missense	probably damaging	1.00
R6402:Ttc37	UTSW	13	76135270	missense	probably benign	0.05
R6561:Ttc37	UTSW	13	76150519	missense	probably damaging	1.00
R6808:Ttc37	UTSW	13	76185179	missense	probably damaging	0.96
R7054:Ttc37	UTSW	13	76134960	missense	probably damaging	1.00
R7261:Ttc37	UTSW	13	76113579	missense	probably benign	0.30
R7267:Ttc37	UTSW	13	76180077	missense	probably benign	0.15
R7348:Ttc37	UTSW	13	76182884	missense	possibly damaging	0.82
R7384:Ttc37	UTSW	13	76150735	missense	possibly damaging	0.53
R7404:Ttc37	UTSW	13	76148747	nonsense	probably null
R7421:Ttc37	UTSW	13	76148825	missense	probably benign	0.12
R7546:Ttc37	UTSW	13	76134835	missense	probably damaging	1.00
R7771:Ttc37	UTSW	13	76135030	missense	probably benign	0.21
R7960:Ttc37	UTSW	13	76112199	missense	probably benign	0.03
R8125:Ttc37	UTSW	13	76130327	critical splice donor site	probably null
R8136:Ttc37	UTSW	13	76113103	missense	probably benign	0.00
X0067:Ttc37	UTSW	13	76132933	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGGTGCAGTCAGATCCTCTC -3'
(R):5'- TTTTAGTAAACACTGCAACCCC -3'

Sequencing Primer
(F):5'- GCAGTCAGATCCTCTCTATGTGTG -3'
(R):5'- CTAGAGGATCAAGGTTCAATTCCCAG -3'

Posted On

2016-07-22