Mutagenetix > Incidental Mutations

Incidental Mutation 'R5208:Lonp1'

402182

Institutional Source

Beutler Lab

Gene Symbol

Lonp1

Ensembl Gene

ENSMUSG00000041168

Gene Name

lon peptidase 1, mitochondrial

Synonyms

1200017E13Rik, LON, Prss15

MMRRC Submission

042783-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56614301-56626903 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56617793 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 538 (V538A)

Ref Sequence

ENSEMBL: ENSMUSP00000041814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000080492]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047226
AA Change: V538A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168
AA Change: V538A

Domain	Start	End	E-Value	Type
LON	111	357	3.95e-62	SMART
low complexity region	389	404	N/A	INTRINSIC
AAA	504	649	1.81e-14	SMART
Pfam:Lon_C	725	938	1e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000080492

SMART Domains

Protein: ENSMUSP00000079340
Gene: ENSMUSG00000057863

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L36e	2	100	2.4e-51	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	C	A	7: 140,298,036	A977D	probably benign	Het
Aadacl4	A	T	4: 144,617,828	N58I	probably benign	Het
Adgra3	T	C	5: 50,011,515	D163G	probably damaging	Het
Alcam	C	A	16: 52,295,048	E236*	probably null	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Aplf	G	T	6: 87,642,026		probably null	Het
Arl4a	A	T	12: 40,036,745	M1K	probably null	Het
Asic4	A	G	1: 75,451,226	D132G	probably damaging	Het
Bbs12	T	C	3: 37,320,273	I290T	probably benign	Het
BC024139	A	G	15: 76,124,665	S290P	probably benign	Het
Bmp6	G	A	13: 38,469,697	A247T	probably benign	Het
Cadps	A	G	14: 12,457,711	S1057P	possibly damaging	Het
Caprin1	A	C	2: 103,769,433		probably null	Het
Cdc42bpg	G	A	19: 6,321,720	R1343K	probably benign	Het
Cdk18	A	T	1: 132,117,480		probably null	Het
Cenpf	A	T	1: 189,671,046		probably null	Het
Cfhr1	A	T	1: 139,556,330		probably null	Het
Chn2	A	T	6: 54,295,801	I201F	probably damaging	Het
Chrdl2	A	G	7: 100,023,922	D175G	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnah3	C	G	7: 120,032,638	D1365H	probably damaging	Het
Efcab8	T	A	2: 153,802,423	Y372*	probably null	Het
Eftud2	G	A	11: 102,841,185	P768S	probably damaging	Het
Ehmt1	A	C	2: 24,801,533	S1170A	probably benign	Het
Gdpd4	A	C	7: 98,014,911	K572Q	probably benign	Het
Gm7356	T	C	17: 14,001,194	E191G	probably damaging	Het
Gm8674	A	T	13: 49,901,921		noncoding transcript	Het
Gulp1	T	G	1: 44,781,039	H235Q	probably benign	Het
Hormad1	T	C	3: 95,578,107	V202A	possibly damaging	Het
Inpp5b	G	A	4: 124,751,317	D179N	possibly damaging	Het
Kcnk4	T	A	19: 6,927,701	Y194F	possibly damaging	Het
Lars	A	C	18: 42,217,557	S896A	probably benign	Het
Map3k14	A	T	11: 103,239,146	L315Q	probably damaging	Het
Met	T	A	6: 17,526,423	Y500*	probably null	Het
Mga	T	G	2: 119,947,981	I2093M	possibly damaging	Het
Mpl	T	G	4: 118,455,881	I152L	probably benign	Het
Mthfsd	G	A	8: 121,108,319		probably benign	Het
Mup4	A	G	4: 59,958,119	F150L	probably damaging	Het
Mybph	T	A	1: 134,193,535	V11D	probably benign	Het
Olfr1278	A	T	2: 111,292,601	E111V	probably damaging	Het
Olfr668	A	G	7: 104,925,726	F13L	probably benign	Het
Olfr988	T	A	2: 85,353,798	I43F	probably benign	Het
Pde4a	T	C	9: 21,203,558		probably null	Het
Pex2	C	T	3: 5,561,368	R127H	probably benign	Het
Pgap3	A	G	11: 98,398,048	W94R	probably damaging	Het
Prl4a1	T	C	13: 28,018,484	V14A	probably benign	Het
Psg25	A	T	7: 18,526,535	I146N	probably benign	Het
Ptprn2	A	G	12: 116,858,928	Y209C	probably damaging	Het
Sema4c	T	A	1: 36,550,326	D573V	probably damaging	Het
Setx	A	T	2: 29,166,367	I2192F	possibly damaging	Het
Sp4	A	G	12: 118,299,546	L255P	probably damaging	Het
Spaca7	A	G	8: 12,586,456	Y94C	probably damaging	Het
Stt3a	T	G	9: 36,746,595	I390L	possibly damaging	Het
Tars2	A	G	3: 95,747,593	W128R	probably damaging	Het
Tll1	G	A	8: 64,051,493	T623M	probably damaging	Het
Tmem129	A	T	5: 33,655,506	V166E	probably damaging	Het
Tmem200a	T	A	10: 25,994,153	I73F	probably benign	Het
Tnks1bp1	T	C	2: 85,070,632	M1561T	probably damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Zfat	A	T	15: 68,180,721	I401N	probably damaging	Het
Zfp142	A	T	1: 74,570,868	V1153E	probably benign	Het
Zwilch	T	C	9: 64,152,923	I354V	probably benign	Het

Other mutations in Lonp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Lonp1	APN	17	56619265	missense	probably damaging	1.00
IGL00934:Lonp1	APN	17	56614683	missense	probably benign	0.21
IGL01065:Lonp1	APN	17	56615500	unclassified	probably benign
IGL01343:Lonp1	APN	17	56615586	missense	possibly damaging	0.93
IGL01734:Lonp1	APN	17	56616026	missense	probably damaging	1.00
IGL02141:Lonp1	APN	17	56615086	missense	probably benign	0.19
IGL02979:Lonp1	APN	17	56621940	missense	probably benign	0.02
chaney	UTSW	17	56622515	missense	probably damaging	1.00
Karloff	UTSW	17	56618406	missense	probably benign
R0015:Lonp1	UTSW	17	56618406	missense	probably benign
R0015:Lonp1	UTSW	17	56618406	missense	probably benign
R0863:Lonp1	UTSW	17	56618331	missense	probably damaging	1.00
R1343:Lonp1	UTSW	17	56620272	missense	probably damaging	1.00
R1735:Lonp1	UTSW	17	56614956	missense	probably damaging	1.00
R1975:Lonp1	UTSW	17	56615068	missense	possibly damaging	0.69
R1976:Lonp1	UTSW	17	56615068	missense	possibly damaging	0.69
R1977:Lonp1	UTSW	17	56615068	missense	possibly damaging	0.69
R2484:Lonp1	UTSW	17	56614659	missense	probably damaging	1.00
R2895:Lonp1	UTSW	17	56615562	missense	probably damaging	1.00
R3123:Lonp1	UTSW	17	56626488	missense	possibly damaging	0.79
R3125:Lonp1	UTSW	17	56626488	missense	possibly damaging	0.79
R3429:Lonp1	UTSW	17	56618337	missense	probably damaging	1.00
R3726:Lonp1	UTSW	17	56618310	unclassified	probably benign
R3767:Lonp1	UTSW	17	56621952	missense	possibly damaging	0.80
R4618:Lonp1	UTSW	17	56622511	missense	probably benign	0.03
R4859:Lonp1	UTSW	17	56626587	missense	probably benign	0.00
R4951:Lonp1	UTSW	17	56620335	missense	possibly damaging	0.64
R5620:Lonp1	UTSW	17	56620263	missense	probably benign	0.05
R5621:Lonp1	UTSW	17	56620263	missense	probably benign	0.05
R5622:Lonp1	UTSW	17	56620263	missense	probably benign	0.05
R6131:Lonp1	UTSW	17	56614457	missense	probably benign	0.01
R6377:Lonp1	UTSW	17	56621961	missense	possibly damaging	0.90
R6692:Lonp1	UTSW	17	56619230	missense	probably damaging	1.00
R7052:Lonp1	UTSW	17	56626549	missense	probably benign	0.31
R7131:Lonp1	UTSW	17	56617814	missense	probably damaging	1.00
R7295:Lonp1	UTSW	17	56622495	missense	possibly damaging	0.70
R7739:Lonp1	UTSW	17	56626620	missense	probably benign
R7792:Lonp1	UTSW	17	56622515	missense	probably damaging	1.00
R8307:Lonp1	UTSW	17	56626573	missense	probably benign	0.01
R8546:Lonp1	UTSW	17	56626702	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACAACTAGTGTACCTCCTTGTC -3'
(R):5'- TGCTGGATGATAGCCCCTTG -3'

Sequencing Primer
(F):5'- TTGTCCCACCCAACCACATGG -3'
(R):5'- GATGATAGCCCCTTGGTCTTTGC -3'

Posted On

2016-07-22