Incidental Mutation 'R0415:Kcnab2'
ID 40219
Institutional Source Beutler Lab
Gene Symbol Kcnab2
Ensembl Gene ENSMUSG00000028931
Gene Name potassium voltage-gated channel, shaker-related subfamily, beta member 2
Synonyms F5, I2rf5, Kcnb3, I2rf5
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R0415 (G1)
Quality Score 211
Status Validated
Chromosome 4
Chromosomal Location 152475201-152562006 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152479593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 248 (F248S)
Ref Sequence ENSEMBL: ENSMUSP00000124588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030768] [ENSMUST00000030775] [ENSMUST00000105648] [ENSMUST00000159186] [ENSMUST00000159840] [ENSMUST00000160884] [ENSMUST00000164662]
AlphaFold P62482
Predicted Effect probably benign
Transcript: ENSMUST00000005175
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030768
AA Change: F219S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030768
Gene: ENSMUSG00000028931
AA Change: F219S

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030775
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105648
AA Change: F233S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101273
Gene: ENSMUSG00000028931
AA Change: F233S

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124423
Predicted Effect probably benign
Transcript: ENSMUST00000159186
AA Change: F248S

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124588
Gene: ENSMUSG00000028931
AA Change: F248S

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 371 4.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159840
AA Change: F219S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124156
Gene: ENSMUSG00000028931
AA Change: F219S

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160884
AA Change: F233S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125058
Gene: ENSMUSG00000028931
AA Change: F233S

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159844
Predicted Effect probably benign
Transcript: ENSMUST00000164662
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Meta Mutation Damage Score 0.5420 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice show strain-specific changes in survival, body weight, thermoregulation and cold-swim induced tremors, impaired associative learning and memory, sporadic seizures and amygala hyperexcitability. Mice homozygous for a knock-in mutationshow no deficits in associative learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dip2c C T 13: 9,618,325 (GRCm39) probably benign Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Lyst T C 13: 13,886,195 (GRCm39) probably benign Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rad51c A G 11: 87,288,481 (GRCm39) L234P probably damaging Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Sult2b1 A G 7: 45,379,516 (GRCm39) probably benign Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Vmn2r74 A C 7: 85,610,618 (GRCm39) C25G probably damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Kcnab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Kcnab2 APN 4 152,478,254 (GRCm39) missense possibly damaging 0.94
IGL02201:Kcnab2 APN 4 152,486,375 (GRCm39) unclassified probably benign
IGL02449:Kcnab2 APN 4 152,496,441 (GRCm39) critical splice donor site probably null
IGL02957:Kcnab2 APN 4 152,520,326 (GRCm39) missense possibly damaging 0.62
R0485:Kcnab2 UTSW 4 152,479,439 (GRCm39) missense probably benign
R1759:Kcnab2 UTSW 4 152,477,509 (GRCm39) missense probably damaging 0.99
R1933:Kcnab2 UTSW 4 152,520,323 (GRCm39) missense possibly damaging 0.66
R3037:Kcnab2 UTSW 4 152,478,213 (GRCm39) missense possibly damaging 0.94
R3913:Kcnab2 UTSW 4 152,479,689 (GRCm39) missense probably damaging 0.99
R4178:Kcnab2 UTSW 4 152,489,058 (GRCm39) missense probably null 1.00
R4863:Kcnab2 UTSW 4 152,486,403 (GRCm39) missense probably damaging 1.00
R4919:Kcnab2 UTSW 4 152,486,397 (GRCm39) missense probably damaging 1.00
R5996:Kcnab2 UTSW 4 152,519,287 (GRCm39) splice site probably null
R6519:Kcnab2 UTSW 4 152,496,450 (GRCm39) missense probably damaging 0.96
R7753:Kcnab2 UTSW 4 152,481,218 (GRCm39) missense probably benign 0.11
R9025:Kcnab2 UTSW 4 152,491,635 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATACTTCCCTGAGACGATGCCG -3'
(R):5'- ACAGGCACCTTGACTCATTGGAAC -3'

Sequencing Primer
(F):5'- agagagagagagagagagagCA -3'
(R):5'- CTTGACTCATTGGAACCGTATGAC -3'
Posted On 2013-05-23