Incidental Mutation 'R5219:Agl'
ID402193
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116778721 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 195 (V195A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably benign
Transcript: ENSMUST00000040603
AA Change: V860A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: V860A

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159742
AA Change: V860A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: V860A

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159995
SMART Domains Protein: ENSMUSP00000125246
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_central 119 197 8.8e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160484
AA Change: V195A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400
AA Change: V195A

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162792
AA Change: V860A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: V860A

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Meta Mutation Damage Score 0.1130 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
R7735:Agl UTSW 3 116785146 missense probably benign 0.21
R7770:Agl UTSW 3 116758237 critical splice donor site probably null
X0065:Agl UTSW 3 116781330 nonsense probably null
Z1177:Agl UTSW 3 116781036 missense
Predicted Primers PCR Primer
(F):5'- CCGTAAAACTGCCCAGATCG -3'
(R):5'- TGGAGTTGCCACAAAGGGTC -3'

Sequencing Primer
(F):5'- AGATCGGGCCACTGGTAG -3'
(R):5'- AGTTCCCAAGATCCATGTCAGGTG -3'
Posted On2016-07-22