Incidental Mutation 'R5219:Orc1'
ID402199
Institutional Source Beutler Lab
Gene Symbol Orc1
Ensembl Gene ENSMUSG00000028587
Gene Nameorigin recognition complex, subunit 1
SynonymsMmORC1, Orc1l
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108579423-108614833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108590769 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 71 (F71S)
Ref Sequence ENSEMBL: ENSMUSP00000099805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102744]
PDB Structure Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102744
AA Change: F71S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: F71S

DomainStartEndE-ValueType
BAH 44 170 1.88e-31 SMART
low complexity region 394 417 N/A INTRINSIC
AAA 505 656 1e-7 SMART
Cdc6_C 757 837 5.45e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143497
Meta Mutation Damage Score 0.4462 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Orc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Orc1 APN 4 108595325 splice site probably benign
IGL00709:Orc1 APN 4 108590778 critical splice donor site probably null
IGL01124:Orc1 APN 4 108588787 splice site probably benign
IGL01514:Orc1 APN 4 108602052 missense probably damaging 0.97
IGL01677:Orc1 APN 4 108604585 missense probably damaging 1.00
IGL01782:Orc1 APN 4 108606268 missense possibly damaging 0.78
IGL01886:Orc1 APN 4 108603957 splice site probably null
IGL01912:Orc1 APN 4 108590744 missense probably damaging 1.00
IGL02057:Orc1 APN 4 108588729 missense possibly damaging 0.53
IGL02155:Orc1 APN 4 108590677 missense probably benign 0.00
IGL02311:Orc1 APN 4 108599974 missense probably benign
IGL02616:Orc1 APN 4 108595479 missense probably benign 0.00
R0012:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0195:Orc1 UTSW 4 108614308 nonsense probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0611:Orc1 UTSW 4 108602032 missense probably benign
R1351:Orc1 UTSW 4 108595367 missense probably benign 0.01
R1966:Orc1 UTSW 4 108612217 missense probably damaging 1.00
R2018:Orc1 UTSW 4 108590700 missense possibly damaging 0.95
R2398:Orc1 UTSW 4 108601969 missense possibly damaging 0.68
R3110:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3112:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3712:Orc1 UTSW 4 108604021 missense probably damaging 1.00
R3716:Orc1 UTSW 4 108614459 missense probably damaging 1.00
R3829:Orc1 UTSW 4 108605631 missense probably damaging 1.00
R4282:Orc1 UTSW 4 108606274 missense probably benign 0.18
R4320:Orc1 UTSW 4 108588776 missense probably benign
R4321:Orc1 UTSW 4 108588776 missense probably benign
R4322:Orc1 UTSW 4 108588776 missense probably benign
R4348:Orc1 UTSW 4 108593452 missense probably damaging 0.98
R4562:Orc1 UTSW 4 108602055 critical splice donor site probably null
R4772:Orc1 UTSW 4 108579568 utr 5 prime probably benign
R4914:Orc1 UTSW 4 108604558 missense probably damaging 1.00
R4964:Orc1 UTSW 4 108614473 makesense probably null
R5428:Orc1 UTSW 4 108599940 missense probably benign 0.00
R5655:Orc1 UTSW 4 108593439 missense probably benign 0.09
R5693:Orc1 UTSW 4 108613079 missense probably benign 0.01
R5936:Orc1 UTSW 4 108601983 missense probably benign 0.10
R5960:Orc1 UTSW 4 108606298 missense possibly damaging 0.67
R6294:Orc1 UTSW 4 108590670 missense probably benign 0.01
R6504:Orc1 UTSW 4 108590717 missense probably benign 0.15
R6533:Orc1 UTSW 4 108597447 missense probably benign 0.05
R6775:Orc1 UTSW 4 108603455 missense probably damaging 1.00
R7123:Orc1 UTSW 4 108588687 start codon destroyed probably damaging 0.99
R7156:Orc1 UTSW 4 108595459 missense probably benign 0.00
R7327:Orc1 UTSW 4 108588714 missense probably benign 0.01
R7552:Orc1 UTSW 4 108588754 missense probably benign 0.41
R7842:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7899:Orc1 UTSW 4 108603371 splice site probably null
R8033:Orc1 UTSW 4 108605564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGTCCTTTAAAAGAATGTTGTC -3'
(R):5'- CTCTAGAAGAACATTCTTGCCCC -3'

Sequencing Primer
(F):5'- CAATGATGGTTCTGAGATTCA -3'
(R):5'- TTGCCCCTAAAAATAATGGAAAGGC -3'
Posted On2016-07-22