Incidental Mutation 'R5219:Trabd2b'
ID402200
Institutional Source Beutler Lab
Gene Symbol Trabd2b
Ensembl Gene ENSMUSG00000070867
Gene NameTraB domain containing 2B
Synonyms
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location114406724-114615098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114602810 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 382 (T382A)
Ref Sequence ENSEMBL: ENSMUSP00000092494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094894]
Predicted Effect probably damaging
Transcript: ENSMUST00000094894
AA Change: T382A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092494
Gene: ENSMUSG00000070867
AA Change: T382A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TraB 41 350 6.2e-67 PFAM
low complexity region 359 402 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 450 469 N/A INTRINSIC
Meta Mutation Damage Score 0.3305 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Trabd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Trabd2b APN 4 114409125 missense probably damaging 0.99
IGL01404:Trabd2b APN 4 114599956 missense probably benign 0.01
IGL01866:Trabd2b APN 4 114408920 missense probably damaging 0.96
IGL03056:Trabd2b APN 4 114409338 missense probably damaging 0.96
IGL03167:Trabd2b APN 4 114609998 missense probably benign
E0374:Trabd2b UTSW 4 114599897 missense probably damaging 0.99
R0645:Trabd2b UTSW 4 114586570 missense probably damaging 1.00
R0744:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R0833:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R1580:Trabd2b UTSW 4 114580334 missense possibly damaging 0.91
R1599:Trabd2b UTSW 4 114408981 missense probably damaging 0.99
R2132:Trabd2b UTSW 4 114610008 missense probably benign
R2133:Trabd2b UTSW 4 114610008 missense probably benign
R2204:Trabd2b UTSW 4 114602994 missense probably damaging 1.00
R2518:Trabd2b UTSW 4 114599903 missense probably damaging 1.00
R4940:Trabd2b UTSW 4 114408944 missense probably damaging 1.00
R4994:Trabd2b UTSW 4 114406855 missense probably benign 0.05
R5104:Trabd2b UTSW 4 114406917 missense probably benign 0.21
R6456:Trabd2b UTSW 4 114586560 missense probably damaging 1.00
R7148:Trabd2b UTSW 4 114409350 missense probably damaging 1.00
R7192:Trabd2b UTSW 4 114610020 missense possibly damaging 0.88
R7195:Trabd2b UTSW 4 114409440 missense probably damaging 1.00
R7375:Trabd2b UTSW 4 114609997 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCTGTCTCTATAGCAGACAGTG -3'
(R):5'- AGAGGTCATTGAACTGCCTTGG -3'

Sequencing Primer
(F):5'- TATAGCAGACAGTGGTTCCCCTG -3'
(R):5'- TGCCTTGGCCGCTGATG -3'
Posted On2016-07-22