Incidental Mutation 'R5219:Gp6'
ID402214
Institutional Source Beutler Lab
Gene Symbol Gp6
Ensembl Gene ENSMUSG00000078810
Gene Nameglycoprotein 6 (platelet)
SynonymsGpvi, 9830166G18Rik
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4363965-4397744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4368999 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 252 (V252A)
Ref Sequence ENSEMBL: ENSMUSP00000104231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108590] [ENSMUST00000206928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108590
AA Change: V252A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104231
Gene: ENSMUSG00000078810
AA Change: V252A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 109 7.47e-3 SMART
IG 120 204 9.86e-3 SMART
transmembrane domain 266 285 N/A INTRINSIC
low complexity region 306 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206928
AA Change: V269A

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.2511 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous with disruptions in this gene display functional abnormalities in their platelets including failure of the platelets to aggregate and to become activated. The effects on blood clotting are minor however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Gp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Gp6 APN 7 4394104 splice site probably benign
IGL02351:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02358:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02660:Gp6 APN 7 4384998 missense probably benign 0.01
IGL03081:Gp6 APN 7 4371648 missense probably benign 0.01
R0112:Gp6 UTSW 7 4370184 missense probably benign 0.08
R0112:Gp6 UTSW 7 4371627 missense probably benign 0.12
R0211:Gp6 UTSW 7 4373209 critical splice donor site probably null
R0356:Gp6 UTSW 7 4370142 splice site probably benign
R2006:Gp6 UTSW 7 4384989 missense probably benign 0.33
R2047:Gp6 UTSW 7 4373271 splice site probably benign
R5571:Gp6 UTSW 7 4368900 missense probably damaging 1.00
R5639:Gp6 UTSW 7 4394131 missense probably damaging 1.00
R6224:Gp6 UTSW 7 4394212 missense probably benign 0.03
R6555:Gp6 UTSW 7 4384930 missense probably damaging 0.99
R7625:Gp6 UTSW 7 4370174 missense probably benign 0.37
R8113:Gp6 UTSW 7 4394115 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTCTTGAGTATGTCCATGTCTG -3'
(R):5'- TCTGACCCCTGTTGGTGATG -3'

Sequencing Primer
(F):5'- TGCATGGATGTCTGGTCAATCCC -3'
(R):5'- ATGGTGGGGGTGATCATTGTAAC -3'
Posted On2016-07-22