Incidental Mutation 'R0415:Fryl'
ID40222
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R0415 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73098414 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 758 (Y758C)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: Y758C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: Y758C

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: Y758C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: Y758C

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201405
SMART Domains Protein: ENSMUSP00000144346
Gene: ENSMUSG00000070733

DomainStartEndE-ValueType
low complexity region 103 114 N/A INTRINSIC
Meta Mutation Damage Score 0.5998 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pth2r A G 1: 65,388,439 M424V probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rad51c A G 11: 87,397,655 L234P probably damaging Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Sfswap A T 5: 129,504,126 D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Trove2 G T 1: 143,760,075 N444K probably benign Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 intron probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCGAACATCCACGCATAGCTC -3'
(R):5'- CGGTGGAAATGTCAGAGACGCATTC -3'

Sequencing Primer
(F):5'- CACGCATAGCTCACGGC -3'
(R):5'- GAGACGCATTCCTTCCTTAAAC -3'
Posted On2013-05-23