Incidental Mutation 'R5219:Ces2h'
ID402225
Institutional Source Beutler Lab
Gene Symbol Ces2h
Ensembl Gene ENSMUSG00000091813
Gene Namecarboxylesterase 2H
SynonymsGm5744
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105000853-105021178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105016646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 171 (V171A)
Ref Sequence ENSEMBL: ENSMUSP00000126773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172032]
Predicted Effect probably damaging
Transcript: ENSMUST00000172032
AA Change: V171A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: V171A

DomainStartEndE-ValueType
Pfam:COesterase 9 537 2.5e-167 PFAM
Pfam:Abhydrolase_3 142 275 4.1e-11 PFAM
Pfam:Peptidase_S9 161 326 3.3e-8 PFAM
coiled coil region 538 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212347
Meta Mutation Damage Score 0.1898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Ces2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Ces2h APN 8 105014484 missense probably benign 0.01
IGL02268:Ces2h APN 8 105019940 missense probably benign 0.00
IGL03133:Ces2h APN 8 105016779 missense probably damaging 1.00
R0138:Ces2h UTSW 8 105018061 missense probably benign 0.01
R0294:Ces2h UTSW 8 105016604 missense probably benign 0.01
R0482:Ces2h UTSW 8 105020271 missense possibly damaging 0.48
R0899:Ces2h UTSW 8 105014550 missense probably damaging 1.00
R1232:Ces2h UTSW 8 105014655 missense probably benign 0.38
R1535:Ces2h UTSW 8 105014486 missense probably benign 0.06
R1738:Ces2h UTSW 8 105019065 critical splice donor site probably null
R1748:Ces2h UTSW 8 105017841 missense probably benign 0.00
R1759:Ces2h UTSW 8 105016611 missense probably damaging 1.00
R1778:Ces2h UTSW 8 105014607 missense possibly damaging 0.93
R1833:Ces2h UTSW 8 105020373 missense possibly damaging 0.93
R1999:Ces2h UTSW 8 105020345 missense probably benign 0.03
R2018:Ces2h UTSW 8 105018398 missense probably damaging 1.00
R2076:Ces2h UTSW 8 105019028 missense probably benign
R2261:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2262:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2356:Ces2h UTSW 8 105015938 missense probably damaging 0.98
R4453:Ces2h UTSW 8 105014656 critical splice donor site probably null
R4656:Ces2h UTSW 8 105014639 missense possibly damaging 0.80
R4732:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R4733:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R5400:Ces2h UTSW 8 105018425 missense probably benign 0.01
R5696:Ces2h UTSW 8 105018979 missense possibly damaging 0.69
R5894:Ces2h UTSW 8 105019026 missense probably benign 0.14
R6688:Ces2h UTSW 8 105017840 missense probably benign
R6711:Ces2h UTSW 8 105018083 missense probably benign 0.22
R6868:Ces2h UTSW 8 105018423 missense probably benign 0.02
R7233:Ces2h UTSW 8 105017456 missense probably damaging 0.99
R7516:Ces2h UTSW 8 105016826 missense probably damaging 1.00
R7710:Ces2h UTSW 8 105000865 nonsense probably null
R7735:Ces2h UTSW 8 105014495 missense probably benign 0.01
R7803:Ces2h UTSW 8 105018400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGTCACTCATAGTATCTGTCTAGG -3'
(R):5'- TTCTGTTGGAGCCAGCGTAG -3'

Sequencing Primer
(F):5'- ACTCATAGTATCTGTCTAGGCAGGC -3'
(R):5'- TAGGGCGGCCACTTGGTC -3'
Posted On2016-07-22