Incidental Mutation 'R5219:Olfr827'
ID402234
Institutional Source Beutler Lab
Gene Symbol Olfr827
Ensembl Gene ENSMUSG00000045559
Gene Nameolfactory receptor 827
SynonymsMOR210-5, GA_x6K02T2PULF-11878777-11877809
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130203049-130214403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130210924 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 69 (T69S)
Ref Sequence ENSEMBL: ENSMUSP00000149200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058123] [ENSMUST00000213568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058123
AA Change: T69S

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089609
Gene: ENSMUSG00000045559
AA Change: T69S

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 6e-53 PFAM
Pfam:7tm_1 53 300 2.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213568
AA Change: T69S

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216253
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Olfr827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Olfr827 APN 10 130210734 missense probably damaging 1.00
IGL02358:Olfr827 APN 10 130210734 missense probably damaging 1.00
R0179:Olfr827 UTSW 10 130210338 missense probably damaging 1.00
R0401:Olfr827 UTSW 10 130210620 missense probably damaging 1.00
R0607:Olfr827 UTSW 10 130211070 missense probably benign 0.33
R1139:Olfr827 UTSW 10 130211079 missense possibly damaging 0.53
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1645:Olfr827 UTSW 10 130210212 missense probably damaging 0.99
R4712:Olfr827 UTSW 10 130210422 missense possibly damaging 0.78
R4966:Olfr827 UTSW 10 130210437 missense probably benign 0.31
R6363:Olfr827 UTSW 10 130211037 missense possibly damaging 0.93
R6734:Olfr827 UTSW 10 130210257 missense probably benign 0.31
R6909:Olfr827 UTSW 10 130210753 missense probably benign
R7180:Olfr827 UTSW 10 130210942 missense probably benign 0.05
R7549:Olfr827 UTSW 10 130210984 missense probably benign 0.01
R7665:Olfr827 UTSW 10 130211261 splice site probably null
R8001:Olfr827 UTSW 10 130210860 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCTGCTAGTATAAAGGCTTC -3'
(R):5'- GCAGAAACTTGCCATGGGTG -3'

Sequencing Primer
(F):5'- GGCTTCTGTTACCATGAAAAGTGC -3'
(R):5'- CTTGCCATGGGTGACAAGG -3'
Posted On2016-07-22