Incidental Mutation 'R5219:Akap10'
ID402236
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61922791 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 43 (S43A)
Ref Sequence ENSEMBL: ENSMUSP00000104350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102650] [ENSMUST00000108710]
Predicted Effect probably benign
Transcript: ENSMUST00000102650
AA Change: S43A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: S43A

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108710
AA Change: S43A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804
AA Change: S43A

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143952
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rcor3 T A 1: 192,137,513 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
R7867:Akap10 UTSW 11 61900446 missense probably damaging 1.00
R7986:Akap10 UTSW 11 61930064 missense probably damaging 1.00
R8079:Akap10 UTSW 11 61930054 missense possibly damaging 0.93
Z1186:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1187:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1188:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1189:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1190:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1191:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1192:Akap10 UTSW 11 61915270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGTAGAAGCCTGTTAG -3'
(R):5'- ATTGCTGTTCAGAGGTTACTTTCTC -3'

Sequencing Primer
(F):5'- CTGTCATCGCAAAAGAAGATAG -3'
(R):5'- TTTCTAAGAACTGACCTATCCCCAGG -3'
Posted On2016-07-22